R. N. K. BAMEZAI, Ph.D.;  F.N.A.Sc;  F.I.M.S.A;  F.A.M.S; F.N.A.

Professor of Genetics and Director (Coordinator) National Centre of Applied Human Genetics
School of Life Sciences
Jawaharlal Nehru University
New Delhi -110067, India.

 

Former Vice Chancellor, SMVDU, Katra, Jammu.

Room No.: 306
Off. Phone: 26704518
Residence: 26189182
Fax.:26103211
E-mail bame0200@mail.jnu.ac.in, bamezai@ncahg.org , bamezai@hotmail.com

Career and Positions Held:

Ph.D. Human Genetics (February 1979) A.I.I.M.S, New Delhi
Research Associate CSIR (1979-1980) A.I.I.M.S, New Delhi.
Lecturer in Human Genetics, Institute of Medical Sciences, B.H.U. (1980-86).
Sr. Lecturer in Human Genetics, Instt. of Medical Sciences, B.H.U. (1986-89).
Associate Professor in Genetics, School of Life Sciences, J.N.U. (1989-96).
Professor of Genetics, School of Life Sciences, J.N.U. (1996 onwards).
Coordinator Bio-Informatics Centre, J.N.U. (1997-1998).
Coordinator National Centre of Applied Human Genetics, SLS, JNU (2002 onwards).
Dean School of Life Sciences (August 2004-2006)
Monbusho Scholar, Japan (1985).
Visiting Faculty, Institute of Life Sciences, Manipal University
Vice Chancellor, Shri Mata Vaishno Devi University (SMVDU), Katra, Jammu, J&K (January 2010 till January 2013)

Membership of International and National Bodies and Science Academies:

  • Council Member of the International Association of Environmental Mutagen Societies (2008 onwards),
  • Fellow of Indian National Science Academy,
  • Fellow of The National Academy of Sciences, India,
  • Fellow of National Academy of Medical Sciences, India,
  • Fellow of International Medical Sciences Academy,
  • Fellow at the Medical Genetics Centre, Sylvius Laboratories, The Netherlands (1998),
  • Fellow at Salzburg, Austria (2000),
  • Member HUGO (Human Genome Organization),
  • Elected member GRC (Guha Research Conference),
  • Member American Society of Human Genetics, U.S.A.,
  • Member editorial advisory board of: Open Bentham Journal on Systems Biology; International Journal of Human Genetics and Indian Journal of Human Genetics, Past editorial Board member of the Indian Journal of Experimental Biology,
  • Ex.-Office bearer and Executive Member of Indian Society of Human Genetics, Executive Committee Member of Indian Society of Cell Biology (Past), Ex. Comm. member of Indian Society of Human Genetics (2009-)
  • Past-Vice-President-Environmental Mutagen Society of India.

Membership of Committees:

  • Member in Different UGC Committees (Plan and Other National and local level-Monitoring and Review Committees),
  • Monitoring committee UGC on University with Potential for Excellence,
  • Member UGC- SAP (Special Assistance Programmes) for dozens of universities,
  • XI Plan committee of the Department of Biotechnology (DBT)  
  • Past Member Executive Council (Pondicherry University; Central Univ.of Jharkhand)
  • Member Court / Academic Councils / Task Forces and Advisory Committees, Faculty Boards, Review Committees in several universities / Research Institutions in different parts of the country.
  • Member Expert Group Committee on Breast Cancer, ICMR
  • UGC Member DBT Task Force on Human resource Development (Past)
  • Member DBT- Research Committee for Rapid Grant for Young Investigators
  • Member DBT Task Force on Chronic Disease Biology-Member Expert Group on Cancer Biology, Biomarkers and Immunology
  • Visitor's (President's) nominee/Member Selection Committees in universities; and research institutes and for UGC Major projects.
  • Member Scientific Advisory Council, Chief Minister, J&K
  • Member Advisory Council on Higher Education, Chief Minister, J&K
  • Member J&K State Innovation Council (as Vice Chancellor, SMVDU, Katra)
  • Former Member-The Independent Ethics Committee, Escorts Heart Institute & Research Centre (since 2008).
  • Former Member JNU- Executive Council (Past); Academic Council (two times), Court and other committees from time to time.
  • Former Chairman, Monitoring Committee-JNU
  • Founder Chairman, Institutional Ethics Review Board-JNU

Current Research  Activity and Achievements:

  • Genetic Susceptibility Mechanisms in Complex Disease: Infectious Diseases (Leprosy, Tuberculosis, Hepatitis); Diabetes; Cancer (In-Vitro and In-Vivo models and Cancer Patient studies) And Rare Syndrome Biology
  • Published >109 papers (NCBI - PubMed database). Papers published in Journals like, Cell; JBC; Int J Cancer; Human Genetics; Breast Cancer Research; Breast Cancer Research and Treatment; PLoS Pathogen; PLoS One; BMC Evolutionary Biol; Cancer lett.; Mut.Res.; J Hum Genet.; Eur J Hum Genet.; J Infect. Dis; J Med. Genet. [see Annexure - i]
  • Acted on the Review panel of both International and National Journals of high repute.
  • NCBI- NIH, USA database entries - 396 GenBank; 28 protein; 14 SNPs and 12 OMIM. [see Annexure - ii]
  • Received Hari Om Ashram Trust- Jagdish Chander Bose Award (UGC) for Research in Life Sciences for the Year 2000.
  • Recipient of Acharya Abinavgupta Samman for monumental work in the field of Human Genetics-given by the then Chief Minister of J&K on behalf of G.M.College of Education and H.E.Society Kashmir, in the year 2003.
  • Delivered Platinum Jubilee Award lecture in the 92nd session of the Indian Science Congress, Ahmedabad (2004-05)
  • Recipient of KECSS award in Genomic Research by the Kashmir Education, Culture & Science Society, New Delhi, in the Year 2009.
  • Delivered Brigadier Khanna Oration entitled, "Sporadic breast cancer – Molecular heterogeneity and microRNA therapeutics" 33rd Annual Conference of Association of Obstetricians and Gynecologists of Delhi- on 25th September, 2011.
  • Received Late L.D. Sanghvi Oration Award for Outstanding Contribution in Human Genetics Research in India. Awarded by the Indian Society of Human Genetics at its 38th Annual Conference at BHU in the Year 2012.
  • Received Padma Shri Award from the President of India in the Year 2012.

Teaching and Research Experience:

  • Teaching and Guiding Research in Universities: >33years (March 1980 onwards).
  • Research Experience:  40 years (1973 onwards).
  • Trained more than 300 researchers in the past 10 years in the area of Human Genetics and Genomics at NCAHG,JNU.
  • Delivered ~ 200 lectures, scientific and public since 2003, all over the country in different institutions. [see Annexure - iii]
  • Supervised Research Grants: INSA, DBT, DAE, UGC.
  • Supervised/Co-supervised Research Students: 25 Ph.D., 10 MD/DM/MPhil, 12 Post-Doctoral; Supervising: 11 Ph.D, 3 Post-Doctoral Fellows.

Visits and Lectures Abroad:

  • Japan 1985
  • France and Germany 1986; Visiting different laboratories
  • U.S.A 1987; Visited different laboratories in Boston and Bar-Harbor, Attending a course at Jackson Laboratory, Bar-Harbor.
  • U.S.A.  1993; Lectured at NIH, Bethesda, Attended a course on Linkage Analysis at the Columbia University, New York.
  • The Netherlands 1998; Fellow at the Medical Genetics Centre, Sylvius Laboratories.
  • Salzburg, Austria 2000; Participated in Salzburg Seminar on Policy, Ethical, --issues in Modern Biotechnology and Human Genomics.
  • Kandy, Sri-Lanka 2000; Delivered a Key-Note Address in a Plenary Session on Bioethical Issues—Human Genome research.
  • Edinburgh, HGM2001; Meeting of the Human Genome Organization.
  • Pattaya-Thailand 2002; Delivered Invited lecture in one of the Symposia in HUGO-PACIFIC meeting and the Asia-Pacific Human Genetics Conference.
  • Tehran- Iran 2003; Delivered invited lecture in the 8th Iran Genetics Society Meeting.
  • Tehran-Iran 2004; Delivered Invited lecture in the ICGEB supported workshop.
  • Lahore, Pakistan 3rd November, 2006; Delivered Invited Lecture on “Recent Trends in Genomics” and chaired a session at Annual Conference of International Medical Academy, Dental College.
  • Tehran-Iran 2007; Delivered an Invited Lecture in the 1st International Congress on Health Genomics and Biotechnology.
  • U.S.A. 2011; India-Yale Leadership Programme in Higher-Education at Yale University and visit to Columbia University, Stoney Brook etc
 

ANNEXURE - I

PUBLICATIONS [From International Database-PUBMED]

  1. Nafis S, Kalaiarasan P, Brojen Singh RK, Husain M, Bamezai RN. Apoptosis regulatory protein-protein interaction demonstrates hierarchical scale-free fractal network. Briefings in bioinformatics. 2014.
  2. Kalaiarasan P, Subbarao N, Bamezai RN. Molecular simulation of Tyr105 phosphorylated pyruvate kinase M2 to understand its structure and dynamics. Journal of molecular modeling. 2014: 20(9):2447.
  3. Singh RK, Srivastava A, Kalaiarasan P, Manvati S, Chopra R, Bamezai RN. mtDNA germ line variation mediated ROS generates retrograde signaling and induces pro-cancerous metabolic features. Scientific reports. 2014: 4:6571.
  4. Srivastava AK, Chopra R, Ali S, Aggarwal S, Vig L, Koul Bamezai RN. Inferring population structure and relationship using minimal independent evolutionary markers in Y-chromosome: a hybrid approach of recursive feature selection for hierarchical clustering. Nucleic acids research. 2014: 42(15):e122.
  5. Pandita A, Kumar B, Manvati S, Vaishnavi S, Singh SK, Bamezai RN. Synergistic Combination of Gemcitabine and Dietary Molecule Induces Apoptosis in Pancreatic Cancer Cells and Down Regulates PKM2 Expression. PloS one. 2014: 9(9):e107154.
  6. Iqbal MA, Gupta V, Gopinath P, Mazurek S, Bamezai RN. Pyruvate kinase M2 and cancer: an updated assessment. FEBS letters 2014, 588(16):2685-2692.
  7. Bairwa NK, Saha A, Gochhait S, Pal R, Gupta V, Bamezai RN. Microsatellite instability: an indirect assay to detect defects in the cellular mismatch repair machinery. Methods Mol Biol. 2014: 1105:497-509.
  8. Gupta V, Arora R, Gochhait S, Bairwa NK, Bamezai RN. Gel-based nonradioactive single-strand conformational polymorphism and mutation detection: limitations and solutions. Methods Mol Biol. 2014: 1105:365-380.
  9. Iqbal MA, Siddiqui FA, Chaman N, Gupta V, Kumar B, Gopinath P, Bamezai RN. Missense mutations in pyruvate kinase m2 promote cancer metabolism, oxidative endurance, anchorage independence, and tumor growth in a dominant negative manner. The Journal of biological chemistry. 2014: 289 (12):8098-8105.
  10. Chopra R, Kalaiarasan P, Ali S, Srivastava AK, Aggarwal S, Garg VK, Bhattacharya SN, Bamezai RN. PARK2 and proinflammatory/anti-inflammatory cytokine gene interactions contribute to the susceptibility to leprosy: a case-control study of North Indian population. BMJ open. 2014: 4 (2):e004239.
  11. Jena M, Srivastava AK, Singh RK, Sharma PR, Das PK, Bamezai RN. NOS2A promoter (CCTTT)n association with TB lacks independent functional correlation amongst Indians. Tuberculosis (Edinb) 2014: 94 (1):81-86.
  12. Mahajan A, Sharma S, Dhar MK, Bamezai RN. Risk factors of type 2 diabetes in population of Jammu and Kashmir, India. Journal of biomedical research. 2013: 27 (5):372-379.
  13. Gupta V, Gopinath P, Iqbal MA, Mazurek S, Wellen KE, Bamezai RN. Interplay between Epigenetics & Cancer Metabolism. Current pharmaceutical design. 2014: 20 (11):1706-1714.
  14. Chopra R, Ali S, Srivastava AK, Aggarwal S, Kumar B, Manvati S, Kalaiarasan P, Jena M, Garg VK, Bhattacharya SN, Bamezai RN. Mapping of PARK2 and PACRG overlapping regulatory region reveals LD structure and functional variants in association with leprosy in unrelated indian population groups. PLoS genetics. 2013: 9 (7):e1003578.
  15. Gupta V, Wellen KE, Mazurek S, Bamezai RN. Pyruvate Kinase M2: Regulatory Circuits and Potential for Therapeutic Intervention. Current pharmaceutical design. 2013.
  16. Iqbal MA, Siddiqui FA, Gupta V, Chattopadhyay S, Gopinath P, Kumar B, Manvati S, Chaman N, Bamezai RN. Insulin enhances metabolic capacities of cancer cells by dual regulation of glycolytic enzyme pyruvate kinase M2. Molecular cancer. 2103: 12:72.
  17. Grossman SR, Andersen KG, Shlyakhter I, Tabrizi S, Winnicki S, Yen A, Park DJ, Griesemer D, Karlsson EK, Wong SH, Cabili M, Adegbola RA, Bamezai RN, Hill AV, Vannberg FO, Rinn JL; 1000 Genomes Project, Lander ES, Schaffner SF, Sabeti PC. Identifying recent adaptations in large-scale genomic data.Cell. 2013 Feb 14;152(4):703-13.
  18. Ali S, Chopra R, Manvati S, Singh YP, Kaul N, Behura A, Mahajan A, Sehajpal P, Gupta S, Dhar MK, Chainy GB, Bhanwer AS, Sharma S, Bamezai RN. Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.PLoS One. 2013;8(3):e58881.
  19. Ali, Shafat. Srivastava, A K. Chopra, R. Aggarwal, S. Garg, VK. Bhattacharya, SN. Bamezai, RN. IL12B SNPs and Copy number variation in IL23R gene associated with susceptibility to leprosy. J Med Genet 2013: 50(1):34-42.
  20. Rai, E. Sharma, S. Kaul, S. Jain, K. Matharoo, K. Bhanwer, S. Bamezai, RN. The interactive effect of SIRT1 promoter region polymorphism on type2 diabetes susceptibility in the North Indian population. PLoS One. 2012: 7 (11), e48621.
  21. Iqbal, M.A. Bamezai R.N. Resveratrol Inhibits Cancer Cell Metabolism by Down Regulating pyruvate Kinase M2 via Inhibition of Mammalian Target of Rapamycin. PLoS One. 2012: 7 (5), e36764.
  22. Ali, S. Chopra, R. Aggarwal, S. Srivastava, AK. Kalaiarasan, P. Malhotra, D. Gochhait, S. Garg, VK. Bhattacharya, SN. Bamezai RN. Association of variants in BAT1-LTA-TNF-BTNL2 genes within 6p21.3 region show graded risk to leprosy in unrelated cohorts of Indian population. Hum Genet. 2012: 131(5),703-16.
  23. Aggarwal, S. Ali, S. Chopra, R. Srivastava, A. Kalaiarasan, P. Malhotra, D. Gochhait, S. Bamezai R.N. Genetic variations and interactions in anti-inflammatory cytokine pathway genes in the outcome of leprosy: a study conducted on a MassARRAY platform. J Infect Dis. 2011: 204, 1264-73.
  24. Srivastava, N. Manvati, S. Srivastava, A. Pal, R. Kalaiarasan, P. Chattopadhyay, S. Gochhait, S. Dua, R. Bamezai RN. miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention. Breast Cancer Res. 2011: 13, R39.
  25. Basu. P. Chandna, P. Bamezai RN. Siddiqi, M. Saranath, D. Lear, A. Ratnam, S. MassARRAY spectrometry is more sensitive than PreTect HPV-Proofer and consensus PCR for type-specific detection of high-risk oncogenic human papillomavirus genotypes in cervical cancer. J Clin Microbiol. 2011: 49, 3537-44.
  26. Pal R, Gochhait S, Chattopadhyay S, Gupta P, Prakash N, Agarwal G, Chaturvedi A, Husain N, Husain SA, Bamezai RN. Functional implication of TRAIL -716 C/T promoter polymorphism on its in vitro and in vivo expression and the susceptibility to sporadic breast tumor. Breast Cancer Res Treat. 2011: 126, 333-43.
  27. Sharma PR, Singh S, Jena M, Mishra G, Prakash R, Das PK, Bamezai RN, Tiwari PK.. et al. Coding and non-coding polymorphisms in VDR gene and susceptibility to pulmonary tuberculosis in tribes, castes and Muslims of Central India. Infect Genet Evol. 2011: 11, 1456-61.
  28. Faridi, N.J., Husain, N., Siddiqi, M.I., Kumar, P. & Bamezai R.N. Identification of missense mutations in exon 16 of factor VIII gene in mild and moderate cases with hemophilia A. Clin Appl Thromb Hemost. 2010: 17, 358-61.
  29. Gupta, V. & Bamezai R.N. Human pyruvate kinase M2: a multifunctional protein. Protein Sci. 2010: 19, 2031-44.
  30. Gupta, V. Kalaiarasan, P. Faheem, M. Singh, N. Iqbal, MA. Bamezai RN. Dominant negative mutations affect oligomerization of human pyruvate kinase M2 isozyme and promote cellular growth and polyploidy. J Biol Chem. 2010: 285, 16864-73.
  31. Lashgary, Z. Khodadadi, A. Singh Y, Houshmand, SM. Mahjoubi, F. Sharma, P. Singh, S. Seyedin, M. Srivastava, A. Ataee, M. Mohammadi, ZS. Rezaei, N. Bamezai RN. Sanati MH. Y chromosome diversity among the Iranian religious groups: a reservoir of genetic variation. Ann Hum Biol. 2010: 38, 364-71.
  32. Pal R, Srivastava N, Chopra R, Gochhait S, Gupta P, Prakash N, Agarwal G, Bamezai RN. Investigation of DNA damage response and apoptotic gene methylation pattern in sporadic breast tumors using high throughput quantitative DNA methylation analysis technology. Mol Cancer. 2010: 9, 303.
  33. Sharma, P., Jain, S., Bamezai R. & Tiwari, P. Increased prevalence of pulmonary tuberculosis in male adults of sahariya tribe of India: a revised survey. Indian J Community Med. 2010: 35, 267-71.
  34. Sharma PR, Jain S, Bamezai RN, Tiwari PK. Utility of serum LDH isoforms in the assessment of mycobacterium tuberculosis induced pathology in TB patients of Sahariya tribe.Indian J Clin Biochem. 2010 Jan;25(1):57-63.
  35. Wong SH, Gochhait S, Malhotra D, Pettersson FH, Teo YY, Khor CC, Rautanen A, Chapman SJ, Mills TC, Srivastava A, Rudko A, Freidin MB, Puzyrev VP, Ali S, Aggarwal S, Chopra R, Reddy BS, Garg VK, Roy S, Meisner S, Hazra SK, Saha B, Floyd S, Keating BJ, Kim C, Fairfax BP, Knight JC, Hill PC, Adegbola RA, Hakonarson H, Fine PE, Pitchappan RM, Bamezai RN, Hill AV, Vannberg FO. Leprosy and the adaptation of human toll-like receptor 1. PLoS Pathog. 2010: 6, e1000979.
  36. Srivastava, N., Gochhait, S., de Boer, P. & Bamezai R.N. Role of H2AX in DNA damage response and human cancers. Mutat. Res. 2009: 681, 180-8.
  37. Sharma S, Rai E, Sharma P, Jena M, Singh S, Darvishi K, Bhat AK, Bhanwer AJ, Tiwari PK, Bamezai RN. The Indian origin of paternal haplogroup R1a1* substantiates the autochthonous origin of Brahmins and the caste system. J Hum Genet. 2009: 54, 47-55.
  38. Gochhait, S., Dar, S., Pal, R., Gupta, P. & Bamezai R.N. Expression of DNA damage response genes indicate progressive breast tumors. Cancer Lett. 2009: 273, 305-11.
  39. Bhattacharya, P. & Bamezai R.K. Biophysical studies with parallel stranded oligoduplex. Gene 2009: 431, 13-7.
  40. Akhtar K, Gupta V, Koul A, Alam N, Bhat R, Bamezai RN. Differential behavior of missense mutations in the intersubunit contact domain of the human pyruvate kinase M2 isozyme. J Biol Chem. 2009: 284, 11971-81.
  41. Stephen, P., Vijayan, R., Bhat, A., Subbarao, N. & Bamezai R.N. Molecular modeling on pyruvate phosphate dikinase of Entamoeba histolytica and in silico virtual screening for novel inhibitors. J Comput Aided Mol. Des. 2008: 22, 647-60.
  42. Srivastava, N., Gochhait, S., Gupta, P. & Bamezai R.N. Copy number alterations of the H2AFX gene in sporadic breast cancer patients. Cancer Genet. Cytogenet. 2008: 180, 121-8.
  43. Hamsi MB, Kumar R, Bhatt A, Bamezai RN, Kumar R, Gupta NP, Das TK, Dada R . Mitochondrial DNA Mutations in etiopathogenesis of male infertility. Indian J Urol. 2008: 24, 150-4.
  44. Gochhait S, Bhatt A, Sharma S, Singh YP, Gupta P, Bamezai RN. Concomitant presence of mutations in mitochondrial genome and p53 in cancer development - a study in north Indian sporadic breast and esophageal cancer patients. Int J Cancer 2008: 123, 2580-6.
  45. Bhattacharya, P., Sharma, S., Gochhait, S. & Bamezai R.N. Biophysical characterization of double-stranded oligonucleotides using ETBR and isothermal fluorescence spectroscopy: implication for SNP genotyping. J Biochem Biophys Methods 2008: 70, 1163-73.
  46. Sharma, S., Rai, E., Bhat, A.K., Bhanwer, A.S. & Bamezai R.N. A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India. BMC Evol Biol. 2007: 7, 232.
  47. Bhat A, Koul A, Sharma S, Rai E, Bukhari SI, Dhar MK, Bamezai RN. The possible role of 10398A and 16189C mtDNA variants in providing susceptibility to T2DM in two North Indian populations: a replicative study. Hum Genet. 2007: 120, 821-6.
  48. Bhat A, Koul A, Rai E, Sharma S, Dhar MK, Bamezai RN. PGC-1 alpha Thr394Thr and Gly482Ser variants are significantly associated with T2DM in two North Indian populations: a replicative case-control study. Hum Genet. 2007: 121, 609-14.
  49. Rai E, Sharma S, Koul A, Bhat AK, Bhanwer AJ, Bamezai RN. Interaction between the UCP2-866G/A, mtDNA 10398G/A and PGC1alpha p.Thr394Thr and p.Gly482Ser polymorphisms in type 2 diabetes susceptibility in North Indian population. Hum Genet. 2007: 122, 535-40.
  50. Kumar R, Bhat A, Bamezai RN, Shamsi MB, Kumar R, Gupta NP, Ammini AC, Aron M, Sharma RK, Dada R.. Necessity of nuclear and mitochondrial genome analysis prior to assisted reproductive techniques/intracytoplasmic sperm injection. Indian J Biochem Biophys. 2007: 44, 437-42.
  51. Gochhait S, Bukhari SI, Bairwa N, Vadhera S, Darvishi K, Raish M, Gupta P, Husain SA, Bamezai RN.. Implication of BRCA2 -26G>A 5' untranslated region polymorphism in susceptibility to sporadic breast cancer and its modulation by p53 codon 72 Arg>Pro polymorphism. Breast Cancer Res. 2007: 9, R71.
  52. Darvishi, K., Sharma, S., Bhat, A.K., Rai, E. &Bamezai R.N. Mitochondrial DNA G10398A polymorphism imparts maternal Haplogroup N a risk for breast and esophageal cancer. Cancer Lett. 2007: 249, 249-55.
  53. Mohammad, S., Taha, A., Bamezai R.N. & Baquer, N.Z. Modulation of glucose transporter (GLUT4) by vanadate and Trigonella in alloxan-diabetic rats. Life Sci. 2006 : 78, 820-4.
  54. Mohammad, S., Taha, A., Akhtar, K., Bamezai R.N. & Baquer, N.Z. In vivo effect of Trigonella foenum graecum on the expression of pyruvate kinase, phosphoenolpyruvate carboxykinase, and distribution of glucose transporter (GLUT4) in alloxan-diabetic rats. Can J Physiol Pharmacol. 2006: 84, 647-54.
  55. Malhotra D, Darvishi K, Lohra M, Kumar H, Grover C, Sood S, Reddy BS, Bamezai RN. Association study of major risk single nucleotide polymorphisms in the common regulatory region of PARK2 and PACRG genes with leprosy in an Indian population. Eur J Hum Genet. 2006: 14, 438-42.
  56. Sharma, S., Saha, A., Rai, E., Bhat, A. &Bamezai R. Human mtDNA hypervariable regions, HVR I and II, hint at deep common maternal founder and subsequent maternal gene flow in Indian population groups. J Hum Genet. 2005: 50, 497-506.
  57. Saha, A., Sharma, S., Bhat, A., Pandit, A. & Bamezai R. Genetic affinity among five different population groups in India reflecting a Y-chromosome gene flow. J Hum Genet. 2005: 50, 49-51.
  58. Saha A, Dhir A, Ranjan A, Gupta V, Bairwa N, Bamezai R. Functional IFNG polymorphism in intron 1 in association with an increased risk to promote sporadic breast cancer. Immunogenetics 2005: 57, 165-71.
  59. Gupta V, Arora R, Ranjan A, Bairwa NK, Malhotra DK, Udhayasuriyan PT, Saha A, Bamezai R.. Gel-based nonradioactive single-strand conformational polymorphism and mutation detection: limitations and solutions. Methods Mol Biol. 2005: 291, 247-61.
  60. Saha, A., Bairwa, N.K. & Bamezai R. Microsatellite instability: an indirect assay to detect defects in the cellular mismatch repair machinery. Methods Mol Biol. 2005: 291, 293-302.
  61. Gupta V, Arora R, Saha A, Dhir A, Kar P, Bamezai R. Novel variations in the signal peptide region of transforming growth factor beta1 gene in patients with hepatitis: a brief report from India. Int J Immunogenet. 2005: 32, 79-82.
  62. Arora R, Saha A, Malhotra D, Rath P, Kar P, Bamezai R. Promoter and intron-1 region polymorphisms in the IFNG gene in patients with hepatitis E. Int J Immunogenet. 2005: 32, 207-12.
  63. Mir MM, Dar NA, Gochhait S, Zargar SA, Ahangar AG, Bamezai RN. p53 mutation profile of squamous cell carcinomas of the esophagus in Kashmir (India): a high-incidence area. Int J Cancer 2005: 116, 62-8.
  64. Malhotra, D., Relhan, V., Reddy, B.S. &Bamezai R. TLR2 Arg677Trp polymorphism in leprosy: revisited. Hum Genet. 2005: 116, 413-5.
  65. Malhotra D, Darvishi K, Sood S, Sharma S, Grover C, Relhan V, Reddy BS, Bamezai RN. IL-10 promoter single nucleotide polymorphisms are significantly associated with resistance to leprosy. Hum Genet. 2005: 118, 295-300.
  66. Wenger SL, Senft JR, Sargent LM, Bamezai R, Bairwa N, Grant SG.. Comparison of established cell lines at different passages by karyotype and comparative genomic hybridization. Biosci Rep. 2004: 24, 631-9.
  67. Saha, A., Gupta, V., Bairwa, N.K., Malhotra, D. & Bamezai R. Transforming growth factor-beta1 genotype in sporadic breast cancer patients from India: status of enhancer, promoter, 5'-untranslated-region and exon-1 polymorphisms. Eur J Immunogenet. 2004: 31, 37-42.
  68. Mohammad, S., Taha, A., Bamezai R.N., Basir, S.F. & Baquer, N.Z. Lower doses of vanadate in combination with trigonella restore altered carbohydrate metabolism and antioxidant status in alloxan-diabetic rats. Clin Chim Acta 2004: 342, 105-14.
  69. Khandpur, S., Bairwa, N.K., Reddy, B.S. & Bamezai R. A study of phenotypic correlation with the genotypic status of HTM regions of KRTHB6 and KRTHB1 genes in monilethrix families of Indian origin. Ann Genet. 2004: 47, 77-84.
  70. Bairwa, N.K., Malhotra, D., Saha, A. & Bamezai R. A novel promoter polymorphism (-71C>T) in KRTHB6 gene in Indian population. Ann Genet. 2004: 47, 125-7.
  71. Anitha, M., Kaur, G., Baquer, N.Z. & Bamezai R. Dominant negative effect of novel mutations in pyruvate kinase-M2. DNA Cell Biol. 2004: 23, 442-9.
  72. Saha, A., Udhayasuriyan, P.T., Bhat, K.V. & Bamezai R. Analysis of Indian population based on Y-STRs reveals existence of male gene flow across different language groups. DNA Cell Biol. 2003: 22, 707-19.
  73. Saha, A., Bairwa, N.K., Ranjan, A., Gupta, V. & Bamezai R. Two novel somatic mutations in the human interleukin 6 promoter region in a patient with sporadic breast cancer. Eur J Immunogenet. 2003: 30, 397-400.
  74. Kumar, H., Malhotra, D., Goswami, S. & Bamezai R.N. How far have we reached in tuberculosis vaccine development? Crit Rev Microbiol. 2003: 29, 297-312.
  75. Singh, A., Singh, S.P. & Bamezai R. Direct and translactational effect of arecoline alkaloid on the clocimum oil-modulated hepatic drug metabolizing enzymes in mice. Food Chem Toxicol. 2000: 38, 627-35.
  76. Saha, A., Husain, S. & Bamezai R. Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile. DNA Cell Biol. 2000: 19, 219-26.
  77. Saha, A. & Bamezai R. Detection of genetic variation in Indian population groups using a novel minisatellite probe and finding relationships through tree construction. J Hum Genet. 2000: 45, 207-11.
  78. Reddy B,S., Kochhar, A.M., Anitha, M.,  Bamezai R. Bloom's syndrome – a first report from india.. Int J Dermatol. 2000: 39 (10), 760-3.
  79. Singh, A., Singh, S.P. &Bamezai R. Modulatory potential of clocimum oil on mouse skin papillomagenesis and the xenobiotic detoxication system. Food Chem Toxicol. 1999: 37, 663-70.
  80. Singh, A., Singh, S.P. & Bamezai R. Inhibitory potential of Chlorella vulgaris (E-25) on mouse skin papillomagenesis and xenobiotic detoxication system. Anticancer Res. 1999: 19, 1887-91.
  81. Sachdeva, G., Kaur, G., Bhutani, L.K. &Bamezai R.N. Lymphoproliferative responses of leprosy patients and healthy controls to nitrocellulose-bound M. leprae antigens. Int J Lepr Other Mycobact Dis. 1999: 67, 133-42.
  82. Singh, A., Singh, S.P. &Bamezai R. Perinatal influence of Chlorella vulgaris (E-25) on hepatic drug metabolizing enzymes and lipid peroxidation. Anticancer Res. 1998: 18, 1509-14.
  83. Singh, A., Singh, S.P. & Bamezai R. Momordica charantia (Bitter Gourd) peel, pulp, seed and whole fruit extract inhibits mouse skin papillomagenesis. Toxicol Lett. 1998: 94, 37-46.
  84. Singh, A., Singh, S.P. & Bamezai R. Postnatal efficacy of Momordica charantia peel, pulp, seed and whole fruit extract in the detoxication pathway of suckling neonates and lactating mice. Cancer Lett. 1998: 122, 121-6.
  85. Kaur, G., Sachdeva, G., Bhutani, L.K. & Bamezai R.N. Rare transcripts of interferon-gamma detected in lepromatous leprosy cases. Int J Lepr Other Mycobact Dis. 1998: 66, 65-6.
  86. Bhalla, A., Sachdeva, G. & Bamezai R. T-cell receptor-gamma rearrangement and c-myb methylation in MNNG-exposed Bloom syndrome B-lymphoblastoid cells. Cancer Lett. 1998: 126, 1-6.
  87. Bhalla, A. & Bamezai R. MNNG-transformed Bloom syndrome B-lymphoblastoids for the detection of Hodgkin's lymphoma-associated antigen in 2D Westerns. Cancer Lett. 1998: 126, 7-15.
  88. Singh, A., Singh, S.P. & Bamezai R. Postnatal efficacy of antioxidants in the detoxification pathway of suckling neonates and lactating mice. Cancer Lett. 1997: 119, 201-6.
  89. Singh, A., Singh, S.P. & Bamezai R. Modulatory influence of arecoline on the phytic acid-altered hepatic biotransformation system enzymes, sulfhydryl content and lipid peroxidation in a murine system. Cancer Lett. 1997: 117, 1-6.
  90. Sachdeva, G., Kaur, G., Bhutani, L.K. & Bamezai R. Genetic variations at the T cell receptor gamma locus in circulating peripheral blood mononuclear cells of clinically categorised leprosy patients. Hum Genet. 1997: 100, 30-4.
  91. Kaur, G., Sachdeva, G., Bhutani, L.K. &Bamezai R. Association of polymorphism at COL3A and CTLA4 loci on chromosome 2q31-33 with the clinical phenotype and in-vitro CMI status in healthy and leprosy subjects: a preliminary study. Hum Genet. 1997: 100, 43-50.
  92. Bamezai R. Planned parenthood and artifical selection. Indian J Exp Biol. 1997: 35, 415.
  93. Singh, A., Singh, S.P. & Bamezai R. Modulatory influence of chlorophyllin on the mouse skin papillomagenesis and xenobiotic detoxication system. Carcinogenesis 1996: 17, 1459-63.
  94. Singh, A., Singh, S.P. &Bamezai R. Postnatal effect of arecoline on chlorophyllin-modulated hepatic biotransformation system enzymes in suckling neonate and lactating mice. Teratog Carcinog Mutagen. 1996: 16, 89-96.
  95. Singh, A., Singh, S.P. & Bamezai R. Effect of arecoline on the curcumin-modulated hepatic biotransformation system enzymes in lactating mice and translactationally exposed F1 pups. Nutr Cancer 1996: 25, 101-10.
  96. Bamezai R. Bloom syndrome: is the gene mapped to the point? Indian J Exp Biol. 1996: 34, 298-301.
  97. Trehan, N. & Bamezai R. Induction of high SCEs in normal cells by 11-12 kDa plasma protein overexpressed in some sleep deprived volunteers. Mutat Res. 1995: 331, 191-6.
  98. Singh, A., Singh, S.P. & Bamezai R. Postnatal modulation of hepatic biotransformation system enzymes via translactational exposure of F1 mouse pups to turmeric and curcumin. Cancer Lett. 1995: 96, 87-93.
  99. Sachdeva, G., Kaur, G. & Bamezai R. Noise-free chemiluminescent detection of human T cell receptor and interleukin-2 receptor genes after optimization of digoxigenin labeled probe concentration. Indian J Exp Biol. 1995: 33, 173-6.
  100. Mann, R.K. & Bamezai R. Protein phosphatase-1 inhibition induces high SCEs in normal whole blood cultures. Indian J Exp Biol. 1995: 33, 710-1.
  101. Husain, S.A., Balasubramanian, S. & Bamezai R. Sister chromatid exchange frequency in breast cancer cases. Cancer Genet Cytogenet. 1992: 61, 142-6.
  102. Bamezai R. & Kumar, N. Sleep deprivation in human males and its effect on SCE rates in chromosomes--a preliminary study. Mutat Res. 1992: 283, 229-32.
  103. Shiraishi, Y., Taguchi, T., Ozawa, M. & Bamezai R. Different mutations responsible for the elevated sister-chromatid exchange frequencies in Bloom syndrome and X-irradiated B-lymphoblastoid cell lines originating from acute leukemia. Mutat Res. 1989: 211, 273-8.
  104. Husain, S.A. & Bamezai R. Chromatid association in acrocentric chromosomes of abnormal sexual development (ASD) cases. Indian J Exp Biol. 1989: 27, 861-3.
  105. Husain, S.A. & Bamezai R. Frequency of acrocentric association in abnormal sexual development in males and females. Indian J Exp Biol. 1989: 27, 761-3.
  106. Bamezai R. Differential BrdU uptake in 3 cell cycles and the resultant 3-way sister-chromatid differentiation at M3 endoreduplicated chromosome level--a hypothesis. Mutat Res. 1989:  226, 137-40.
  107. Saxena, A.K. & Bamezai R. Visualization and comparison of protein bands in the same SDS-PAG with simultaneous use of three different stains. Indian J Exp Biol. 1988: 26, 866-8.
  108. Husain, S.A. & Bamezai R. Sister-chromatid exchange (SCE) rate in normal and abnormal sexual development in males and females. Mutat Res. 1988: 206, 261-70.
  109. Bamezai R. & Husain, S.A. Folate sensitive and BrdU dependent fragile sites on human chromosomes. Indian J Exp Biol. 1988: 26, 214-6.
  110. Bamezai R. & Shiraishi, Y. Cell cycle rate and sister chromatid exchange profile in polyethylene glycol-exposed/unexposed Bloom syndrome and normal cells. A co-culture study. Hum Genet. 1987: 75, 356-8.
  111. Bamezai R. & Shiraishi, Y. Three-way differentiation of sister chromatids in endoreduplicated (M3) chromosomes of Bloom syndrome B-lymphoid cell line. Hum Genet. 1987: 75, 239-43.
  112. Bamezai R., Husain, S.A., Misra, S. & Thacker, A.K. Cerebellar ataxia and total albinism. Clin Genet. 1987: 31, 178-81.
  113. Bamezai R., Shiraishi, Y. & Taguchi, H. Centromere spreading in a case of megaloblastic anemia "cured" under TC 199 culture conditions. Cancer Genet Cytogenet. 1986: 20, 341-3.
  114. Bamezai R. & Shiraishi, Y. Cell cycle progression and SCE rate of Bloom syndrome cells with/without co-cultivation in the presence/absence of normal cells. Exp Cell Res. 1986: 164, 163-73.
  115. Bamezai R., Singh, G., Khanna, N.N. & Singh, S. Genetics of site specific colon cancer: a family study. Clin Genet. 1984: 26, 129-32.
  116. Bamezai R. New fragile sites in a 'D' group chromosome-13 in human lymphocytes. Indian J Exp Biol. 1984: 22, 479-81.
  117. Bamezai R. X-linked sterility and lethality--a working hypothesis to explain abnormal sexual development. Indian J Exp Biol. 1984: 22, 233-8.
  118. Singh, N.K., Singh, D.S., Srivastava, P.K., Dube, R.K. &Bamezai R. Lymphoblastic crisis in chronic myeloid leukemia. J Assoc Physicians India 1983: 31, 377-8.
  119. Bamezai R. Cell indices in amniotic fluid as indicators of gestational age: with comparison of two stains. Acta Cytol. 1983: 27, 380-2.
  120. Bamezai R. Prospective genetic counselling in mothers at risk to produce premature low birth weight babies prone to respiratory distress syndrome or neurological disorders. Indian J Exp Biol. 1983: 21, 73-5.
  121. Bamezai R. & Verma, I.C. Lipid-laden cells in amniotic fluid and the lecithin-sphingomyelin ratio. Acta Cytol. 1982: 26, 99.
  122. Bamezai R. & Singh, S. Microtechnique for leukocyte culture from whole blood without serum supplementation. Indian J Exp Biol. 1982: 20, 756-8.
  123. Bamezai R. methods of chromosomal studies in amniotic fluid. Indian J Exp Biol. 1981: 19(8), 746-8.
  124. Bamezai R., Verma, I.C., Kucheria, K. & Hingoran, V. Amniotic fluid cytology gestational age and fetal maturity. Indian J Pediatr. 1980: 47, 51-6.
  125.  Kucheria, K., Bhargava, S.K., Bamezai R. & Bhutani, P. A familial tetraphocomelia syndrome involving limb deformities, cleft lip, cleft palate, and associated anomalies--a new syndrome. Hum Genet. 1976: 33, 323-6.

[Please Note that this list does not include more than 10 papers published in proceedings, and journals not covered by PubMed]

CHAPTERS IN BOOKS

  1. Saha A, Bairwa NK, Bamezai R. Microsatellite instability: an indirect assay to detect defects in the cellular mismatch repair machinery. Methods Mol Biol. 2005; 291: 293-302.
  2. Gupta V, Arora R, Ranjan A, Bairwa NK, Malhotra DK, Udhayasuriyan PT, Saha A, Bamezai R. Gel-based nonradioactive single-strand conformational polymorphism and mutation detection: limitations and solutions. Methods Mol Biol. 2005; 291: 247-61.
  3. Gochhait S, Malhotra D, Rai E, and Bamezai R Automated Fluoroscence Sequencing and Troubleshooting. Springer Verlag, Advance Techniques in Soil Microbiology 2007:11:35-52.
  4. Gochhait S, Bukhari S.I, and Bamezai R mRNA Quantitation Using Real Time PCR. Springer Verlag, Advance Techniques in Soil Microbiology 2007:11:53-72.

 

ANNEXURE - II

CONTRIBUTIONS IN THE INTERNATIONAL GENOME DATABASE

GenBank Accessions:

Contributions To International Genome Database (2002-09)

GenBank Accessions:

Nucleotides:

1: NM_002284
Homo sapiens keratin 86 (KRT86), mRNA
gi|109637786|ref|NM_002284.3| [109637786]

2: EU600396
Homo sapiens NADH dehydrogenase subunit 5-like (ND5) gene, partial sequence; mitochondrial
gi|193090102|gb|EU600396.1| [193090102]

3: EU586511
Homo sapiens isolate 4S-9F cytochrome c oxidase subunit I (cox1) gene, complete cds; mitochondrial
gi|192335152|gb|EU586511.1| [192335152]

4: EU563241
Homo sapiens clone B07 ATPase subunit 6 (ATP6) and cytochrome c oxidase subunit III (COX3) genes, partial cds; mitochondrial
gi|187729690|gb|EU563241.1| [187729690]

5: EU569685
Homo sapiens isolate E03_350-12f cytochrome c oxidase subunit II (COX2) gene, partial cds; mitochondrial
gi|186968863|gb|EU569685.1| [186968863]

6: EU239655
Homo sapiens isolate pH49m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948168|gb|EU239655.1| [160948168]

7: EU239654
Homo sapiens isolate pH48m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948167|gb|EU239654.1| [160948167]

8: EU239653
Homo sapiens isolate pH47m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948166|gb|EU239653.1| [160948166]

9: EU239652
Homo sapiens isolate pH46m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948165|gb|EU239652.1| [160948165]

10: EU239651
Homo sapiens isolate pH44m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948164|gb|EU239651.1| [160948164]

11: EU239650
Homo sapiens isolate pH43m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948163|gb|EU239650.1| [160948163]

12: EU239649
Homo sapiens isolate pH42m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948162|gb|EU239649.1| [160948162]

13: EU239648
Homo sapiens isolate pH41m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948161|gb|EU239648.1| [160948161]

14: EU239647
Homo sapiens isolate pH39m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948160|gb|EU239647.1| [160948160]

15: EU239646
Homo sapiens isolate pH38m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948159|gb|EU239646.1| [160948159]

16: EU239645
Homo sapiens isolate pH37m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948158|gb|EU239645.1| [160948158]

17: EU239644
Homo sapiens isolate pH36m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948157|gb|EU239644.1| [160948157]

18: EU239643
Homo sapiens isolate pH35am D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948156|gb|EU239643.1| [160948156]

19: EU239642
Homo sapiens isolate pH34m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948155|gb|EU239642.1| [160948155]

20: EU239641
Homo sapiens isolate pH32m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948154|gb|EU239641.1| [160948154]

21: EU239640
Homo sapiens isolate pH31m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948153|gb|EU239640.1| [160948153]

22: EU239639
Homo sapiens isolate pH30m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948152|gb|EU239639.1| [160948152]

23: EU239638
Homo sapiens isolate pH29m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948151|gb|EU239638.1| [160948151]

24: EU239637
Homo sapiens isolate pH28m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948150|gb|EU239637.1| [160948150]

25: EU239636
Homo sapiens isolate pH27m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948149|gb|EU239636.1| [160948149]

26: EU239635
Homo sapiens isolate pH26m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948148|gb|EU239635.1| [160948148]

27: EU239634
Homo sapiens isolate pH25m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948147|gb|EU239634.1| [160948147]

28: EU239633
Homo sapiens isolate pH35m D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948146|gb|EU239633.1| [160948146]

29: EU239632
Homo sapiens isolate PH241Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948145|gb|EU239632.1| [160948145]

30: EU239631
Homo sapiens isolate PH99Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948144|gb|EU239631.1| [160948144]

31: EU239630
Homo sapiens isolate PH98Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948143|gb|EU239630.1| [160948143]

32: EU239629
Homo sapiens isolate PH97Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948142|gb|EU239629.1| [160948142]

33: EU239628
Homo sapiens isolate PH96Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948141|gb|EU239628.1| [160948141]

34: EU239627
Homo sapiens isolate PH94Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948140|gb|EU239627.1| [160948140]

35: EU239626
Homo sapiens isolate PH93Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948139|gb|EU239626.1| [160948139]

36: EU239625
Homo sapiens isolate PH92Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948138|gb|EU239625.1| [160948138]

37: EU239624
Homo sapiens isolate PH88Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948137|gb|EU239624.1| [160948137]

38: EU239623
Homo sapiens isolate PH86Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948136|gb|EU239623.1| [160948136]

39: EU239622
Homo sapiens isolate PH85Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948135|gb|EU239622.1| [160948135]

40: EU239621
Homo sapiens isolate PH79Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948134|gb|EU239621.1| [160948134]

41: EU239620
Homo sapiens isolate PH77Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948133|gb|EU239620.1| [160948133]

42: EU239619
Homo sapiens isolate PH76Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948132|gb|EU239619.1| [160948132]

43: EU239618
Homo sapiens isolate PH75Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948131|gb|EU239618.1| [160948131]

44: EU239617
Homo sapiens isolate PH73Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948130|gb|EU239617.1| [160948130]

45: EU239616
Homo sapiens isolate PH39Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948129|gb|EU239616.1| [160948129]

46: EU239615
Homo sapiens isolate PH28Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948128|gb|EU239615.1| [160948128]

47: EU239614
Homo sapiens isolate PH25Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948127|gb|EU239614.1| [160948127]

48: EU239613
Homo sapiens isolate PH9bY D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948126|gb|EU239613.1| [160948126]

49: EU239612
Homo sapiens isolate PH7Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948125|gb|EU239612.1| [160948125]

50: EU239611
Homo sapiens isolate PH6Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948124|gb|EU239611.1| [160948124]

51: EU239610
Homo sapiens isolate PH4Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948123|gb|EU239610.1| [160948123]

52: EU239609
Homo sapiens isolate PH3Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948122|gb|EU239609.1| [160948122]

53: EU239608
Homo sapiens isolate PH1Y D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948121|gb|EU239608.1| [160948121]

54: EU239607
Homo sapiens isolate PH-50 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948120|gb|EU239607.1| [160948120]

55: EU239606
Homo sapiens isolate PH-49 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948119|gb|EU239606.1| [160948119]

56: EU239605
Homo sapiens isolate PH-48 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948118|gb|EU239605.1| [160948118]

57: EU239604
Homo sapiens isolate PH-47 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948117|gb|EU239604.1| [160948117]

58: EU239603
Homo sapiens isolate PH-46 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948116|gb|EU239603.1| [160948116]

59: EU239602
Homo sapiens isolate PH-45 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948115|gb|EU239602.1| [160948115]

60: EU239601
Homo sapiens isolate PH-43 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948114|gb|EU239601.1| [160948114]

61: EU239600
Homo sapiens isolate PH-38 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948113|gb|EU239600.1| [160948113]

62: EU239599
Homo sapiens isolate PH-36 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948112|gb|EU239599.1| [160948112]

63: EU239598
Homo sapiens isolate PH-35 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948111|gb|EU239598.1| [160948111]

64: EU239597
Homo sapiens isolate PH-34 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948110|gb|EU239597.1| [160948110]

65: EU239596
Homo sapiens isolate PH-33 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948109|gb|EU239596.1| [160948109]

66: EU239595
Homo sapiens isolate PH-32 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948108|gb|EU239595.1| [160948108]

67: EU239594
Homo sapiens isolate PH-31 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948107|gb|EU239594.1| [160948107]

68: EU239593
Homo sapiens isolate PH-28 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948106|gb|EU239593.1| [160948106]

69: EU239592
Homo sapiens isolate PH-26 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948105|gb|EU239592.1| [160948105]

70: EU239591
Homo sapiens isolate PH-22 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948104|gb|EU239591.1| [160948104]

71: EU239590
Homo sapiens isolate PH-20 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948103|gb|EU239590.1| [160948103]

72: EU239589
Homo sapiens isolate PH-17 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948102|gb|EU239589.1| [160948102]

73: EU239588
Homo sapiens isolate PH-14 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948101|gb|EU239588.1| [160948101]

74: EU239587
Homo sapiens isolate PH-10 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948100|gb|EU239587.1| [160948100]

75: EU239586
Homo sapiens isolate PH-9 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948099|gb|EU239586.1| [160948099]

76: EU239585
Homo sapiens isolate PH-5 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948098|gb|EU239585.1| [160948098]

77: EU239584
Homo sapiens isolate PH-3 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948097|gb|EU239584.1| [160948097]

78: EU239583
Homo sapiens isolate PH-1 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948096|gb|EU239583.1| [160948096]

79: EU239582
Homo sapiens isolate Ar135 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948095|gb|EU239582.1| [160948095]

80: EU239581
Homo sapiens isolate Ar128 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948094|gb|EU239581.1| [160948094]

81: EU239580
Homo sapiens isolate Ar126 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948093|gb|EU239580.1| [160948093]

82: EU239579
Homo sapiens isolate Ar102 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948092|gb|EU239579.1| [160948092]

83: EU239578
Homo sapiens isolate Ar85 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948091|gb|EU239578.1| [160948091]

84: EU239577
Homo sapiens isolate Ar74 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948090|gb|EU239577.1| [160948090]

85: EU239576
Homo sapiens isolate Ar68 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948089|gb|EU239576.1| [160948089]

86: EU239575
Homo sapiens isolate Ar67 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948088|gb|EU239575.1| [160948088]

87: EU239574
Homo sapiens isolate Ar58 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948087|gb|EU239574.1| [160948087]

88: EU239573
Homo sapiens isolate Ar57 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948086|gb|EU239573.1| [160948086]

89: EU239572
Homo sapiens isolate Ar56 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948085|gb|EU239572.1| [160948085]

90: EU239571
Homo sapiens isolate Ar53 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948084|gb|EU239571.1| [160948084]

91: EU239570
Homo sapiens isolate Ar48 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948083|gb|EU239570.1| [160948083]

92: EU239569
Homo sapiens isolate Ar42 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948082|gb|EU239569.1| [160948082]

93: EU239568
Homo sapiens isolate Ar38 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948081|gb|EU239568.1| [160948081]

94: EU239567
Homo sapiens isolate Ar34 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948080|gb|EU239567.1| [160948080]

95: EU239566
Homo sapiens isolate Ar22 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948079|gb|EU239566.1| [160948079]

96: EU239565
Homo sapiens isolate Ar21 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948078|gb|EU239565.1| [160948078]

97: EU239564
Homo sapiens isolate Ar20 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948077|gb|EU239564.1| [160948077]

98: EU239563
Homo sapiens isolate Ar19 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948076|gb|EU239563.1| [160948076]

99: EU239562
Homo sapiens isolate Ar16 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948075|gb|EU239562.1| [160948075]

100: EU239561
Homo sapiens isolate Ar15 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948074|gb|EU239561.1| [160948074]

101: EU239560
Homo sapiens isolate Ar2 D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948073|gb|EU239560.1| [160948073]

102: EU239559
Homo sapiens isolate pH24E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948072|gb|EU239559.1| [160948072]

103: EU239558
Homo sapiens isolate pH23E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948071|gb|EU239558.1| [160948071]

104: EU239557
Homo sapiens isolate pH22E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948070|gb|EU239557.1| [160948070]

105: EU239556
Homo sapiens isolate pH21E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948069|gb|EU239556.1| [160948069]

106: EU239555
Homo sapiens isolate pH20E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948068|gb|EU239555.1| [160948068]

107: EU239554
Homo sapiens isolate pH19E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948067|gb|EU239554.1| [160948067]

108: EU239553
Homo sapiens isolate pH18E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948066|gb|EU239553.1| [160948066]

109: EU239552
Homo sapiens isolate pH17E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948065|gb|EU239552.1| [160948065]

110: EU239551
Homo sapiens isolate pH16E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948064|gb|EU239551.1| [160948064]

111: EU239550
Homo sapiens isolate pH15E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948063|gb|EU239550.1| [160948063]

112: EU239549
Homo sapiens isolate pH14E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948062|gb|EU239549.1| [160948062]

113: EU239548
Homo sapiens isolate pH13E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948061|gb|EU239548.1| [160948061]

114: EU239547
Homo sapiens isolate pH12E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948060|gb|EU239547.1| [160948060]

115: EU239546
Homo sapiens isolate pH11E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948059|gb|EU239546.1| [160948059]

116: EU239545
Homo sapiens isolate pH10E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948058|gb|EU239545.1| [160948058]

117: EU239544
Homo sapiens isolate pH9E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948057|gb|EU239544.1| [160948057]

118: EU239543
Homo sapiens isolate pH7aE D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948056|gb|EU239543.1| [160948056]

119: EU239542
Homo sapiens isolate pH7E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948055|gb|EU239542.1| [160948055]

120: EU239541
Homo sapiens isolate pH6E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948054|gb|EU239541.1| [160948054]

121: EU239540
Homo sapiens isolate pH5E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948053|gb|EU239540.1| [160948053]

122: EU239539
Homo sapiens isolate pH4E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948052|gb|EU239539.1| [160948052]

123: EU239538
Homo sapiens isolate pH3E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948051|gb|EU239538.1| [160948051]

124: EU239537
Homo sapiens isolate pH2E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948050|gb|EU239537.1| [160948050]

125: EU239536
Homo sapiens isolate pH1E D-loop, partial sequence; tRNA-Phe gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial
gi|160948049|gb|EU239536.1| [160948049]

126: EU181364
Homo sapiens isolate PH88Yb control region, partial sequence; mitochondrial
gi|158266574|gb|EU181364.1| [158266574]

127: EU181363
Homo sapiens isolate PHY2b control region, partial sequence; mitochondrial
gi|158266573|gb|EU181363.1| [158266573]

128: EU181362
Homo sapiens isolate PH25Y2b control region, partial sequence; mitochondrial
gi|158266572|gb|EU181362.1| [158266572]

129: EU181361
Homo sapiens isolate PH76Y2b control region, partial sequence; mitochondrial
gi|158266571|gb|EU181361.1| [158266571]

130: EU181360
Homo sapiens isolate PH98Y2 control region, partial sequence; mitochondrial
gi|158266570|gb|EU181360.1| [158266570]

131: EU181359
Homo sapiens isolate PH85Yb control region, partial sequence; mitochondrial
gi|158266569|gb|EU181359.1| [158266569]

132: EU181358
Homo sapiens isolate PH24Y2b control region, partial sequence; mitochondrial
gi|158266568|gb|EU181358.1| [158266568]

133: EU181357
Homo sapiens isolate PH77Y2b control region, partial sequence; mitochondrial
gi|158266567|gb|EU181357.1| [158266567]

134: EU181356
Homo sapiens isolate PH86Y2b control region, partial sequence; mitochondrial
gi|158266566|gb|EU181356.1| [158266566]

135: EU181355
Homo sapiens isolate PH9bY2 control region, partial sequence; mitochondrial
gi|158266565|gb|EU181355.1| [158266565]

136: EU181354

Homo sapiens isolate PH97Y2b control region, partial sequence; mitochondrial
gi|158266564|gb|EU181354.1| [158266564]

137: EU181353
Homo sapiens isolate PH79Y2b control region, partial sequence; mitochondrial
gi|158266563|gb|EU181353.1| [158266563]

138: EU181352
Homo sapiens isolate PH28Y2 control region, partial sequence; mitochondrial
gi|158266562|gb|EU181352.1| [158266562]

139: EU181351
Homo sapiens isolate PH93Y2b control region, partial sequence; mitochondrial
gi|158266561|gb|EU181351.1| [158266561]

140: EU181350
Homo sapiens isolate PH75Yb control region, partial sequence; mitochondrial
gi|158266560|gb|EU181350.1| [158266560]

141: EU181349
Homo sapiens isolate PH92Y2 control region, partial sequence; mitochondrial
gi|158266559|gb|EU181349.1| [158266559]

142: EU181348
Homo sapiens isolate pH47m control region, partial sequence; mitochondrial
gi|158266558|gb|EU181348.1| [158266558]

143: EU181347
Homo sapiens isolate pH32m control region, partial sequence; mitochondrial
gi|158266557|gb|EU181347.1| [158266557]

144: EU181346
Homo sapiens isolate pH38m control region, partial sequence; mitochondrial
gi|158266556|gb|EU181346.1| [158266556]

145: EU181345
Homo sapiens isolate pH42m control region, partial sequence; mitochondrial
gi|158266555|gb|EU181345.1| [158266555]

146: EU181344
Homo sapiens isolate pH28m control region, partial sequence; mitochondrial
gi|158266554|gb|EU181344.1| [158266554]

147: EU181343
Homo sapiens isolate pH44m control region, partial sequence; mitochondrial
gi|158266553|gb|EU181343.1| [158266553]

148: EU181342
Homo sapiens isolate pH46m control region, partial sequence; mitochondrial
gi|158266552|gb|EU181342.1| [158266552]

149: EU181341
Homo sapiens isolate pH25m control region, partial sequence; mitochondrial
gi|158266551|gb|EU181341.1| [158266551]

150: EU181340
Homo sapiens isolate pH35am control region, partial sequence; mitochondrial
gi|158266550|gb|EU181340.1| [158266550]

151: EU181339
Homo sapiens isolate pH36m control region, partial sequence; mitochondrial
gi|158266549|gb|EU181339.1| [158266549]

152: EU181338
Homo sapiens isolate pH39m control region, partial sequence; mitochondrial
gi|158266548|gb|EU181338.1| [158266548]

153: EU181337
Homo sapiens isolate pH29m control region, partial sequence; mitochondrial
gi|158266547|gb|EU181337.1| [158266547]

154: EU181336
Homo sapiens isolate pH40m control region, partial sequence; mitochondrial
gi|158266546|gb|EU181336.1| [158266546]

155: EU181335
Homo sapiens isolate pH26m control region, partial sequence; mitochondrial
gi|158266545|gb|EU181335.1| [158266545]

156: EU181334
Homo sapiens isolate pH34m control region, partial sequence; mitochondrial
gi|158266544|gb|EU181334.1| [158266544]

157: EU181333
Homo sapiens isolate pH35bm control region, partial sequence; mitochondrial
gi|158266543|gb|EU181333.1| [158266543]

158: EU181332
Homo sapiens isolate pH48m control region, partial sequence; mitochondrial
gi|158266542|gb|EU181332.1| [158266542]

159: EU181331
Homo sapiens isolate pH45m control region, partial sequence; mitochondrial
gi|158266541|gb|EU181331.1| [158266541]

160: EU181330
Homo sapiens isolate pH49m control region, partial sequence; mitochondrial
gi|158266540|gb|EU181330.1| [158266540]

161: EU181329
Homo sapiens isolate pH4m control region, partial sequence; mitochondrial
gi|158266539|gb|EU181329.1| [158266539]

162: EU181328
Homo sapiens isolate pH27m control region, partial sequence; mitochondrial
gi|158266538|gb|EU181328.1| [158266538]

163: EU181327
Homo sapiens isolate PH26 control region, partial sequence; mitochondrial
gi|158266537|gb|EU181327.1| [158266537]

164: EU181326
Homo sapiens isolate PH48 control region, partial sequence; mitochondrial
gi|158266536|gb|EU181326.1| [158266536]

165: EU181325
Homo sapiens isolate PH5 control region, partial sequence; mitochondrial
gi|158266535|gb|EU181325.1| [158266535]

166: EU181324
Homo sapiens isolate PH35 control region, partial sequence; mitochondrial
gi|158266534|gb|EU181324.1| [158266534]

167: EU181323
Homo sapiens isolate PH58 control region, partial sequence; mitochondrial
gi|158266533|gb|EU181323.1| [158266533]

168: EU181322
Homo sapiens isolate PH38 control region, partial sequence; mitochondrial
gi|158266532|gb|EU181322.1| [158266532]

169: EU181321
Homo sapiens isolate PH47 control region, partial sequence; mitochondrial
gi|158266531|gb|EU181321.1| [158266531]

170: EU181320
Homo sapiens isolate Ph3a control region, partial sequence; mitochondrial
gi|158266530|gb|EU181320.1| [158266530]

171: EU181319
Homo sapiens isolate PH3 control region, partial sequence; mitochondrial
gi|158266529|gb|EU181319.1| [158266529]

172: EU181318
Homo sapiens isolate PH32 control region, partial sequence; mitochondrial
gi|158266528|gb|EU181318.1| [158266528]

173: EU181317
Homo sapiens isolate PH28 control region, partial sequence; mitochondrial
gi|158266527|gb|EU181317.1| [158266527]

174: EU181316
Homo sapiens isolate PH9 control region, partial sequence; mitochondrial
gi|158266526|gb|EU181316.1| [158266526]

175: EU181315
Homo sapiens isolate PH7 control region, partial sequence; mitochondrial
gi|158266525|gb|EU181315.1| [158266525]

176: EU181314
Homo sapiens isolate PH34 control region, partial sequence; mitochondrial
gi|158266524|gb|EU181314.1| [158266524]

177: EU181313
Homo sapiens isolate PH4 control region, partial sequence; mitochondrial
gi|158266523|gb|EU181313.1| [158266523]

178: EU181312
Homo sapiens isolate PH22 control region, partial sequence; mitochondrial
gi|158266522|gb|EU181312.1| [158266522]

179: EU181311
Homo sapiens isolate PH46 control region, partial sequence; mitochondrial
gi|158266521|gb|EU181311.1| [158266521]

180: EU181310
Homo sapiens isolate PH0 control region, partial sequence; mitochondrial
gi|158266520|gb|EU181310.1| [158266520]

181: EU181309
Homo sapiens isolate PH36 control region, partial sequence; mitochondrial
gi|158266519|gb|EU181309.1| [158266519]

182: EU181308
Homo sapiens isolate PhaK control region, partial sequence; mitochondrial
gi|158266518|gb|EU181308.1| [158266518]

183: EU181307
Homo sapiens isolate Ph7aK control region, partial sequence; mitochondrial
gi|158266517|gb|EU181307.1| [158266517]

184: EU181306
Homo sapiens isolate Ph0K control region, partial sequence; mitochondrial
gi|158266516|gb|EU181306.1| [158266516]

185: EU181305
Homo sapiens isolate Ph8aK control region, partial sequence; mitochondrial
gi|158266515|gb|EU181305.1| [158266515]

186: EU181304
Homo sapiens isolate Ph4aK control region, partial sequence; mitochondrial
gi|158266514|gb|EU181304.1| [158266514]

187: EU181303
Homo sapiens isolate PhK control region, partial sequence; mitochondrial
gi|158266513|gb|EU181303.1| [158266513]

188: EU181302
Homo sapiens isolate Ph7K control region, partial sequence; mitochondrial
gi|158266512|gb|EU181302.1| [158266512]

189: EU181301
Homo sapiens isolate Ph24K control region, partial sequence; mitochondrial
gi|158266511|gb|EU181301.1| [158266511]

190: EU181300
Homo sapiens isolate Ph4K control region, partial sequence; mitochondrial
gi|158266510|gb|EU181300.1| [158266510]

191: EU181299
Homo sapiens isolate Ph25K control region, partial sequence; mitochondrial
gi|158266509|gb|EU181299.1| [158266509]

192: EU181298
Homo sapiens isolate Ph9K control region, partial sequence; mitochondrial
gi|158266508|gb|EU181298.1| [158266508]

193: EU181297
Homo sapiens isolate Ph2K control region, partial sequence; mitochondrial
gi|158266507|gb|EU181297.1| [158266507]

194: EU181296
Homo sapiens isolate Ph8K control region, partial sequence; mitochondrial
gi|158266506|gb|EU181296.1| [158266506]

195: EU181295
Homo sapiens isolate Ph20K control region, partial sequence; mitochondrial
gi|158266505|gb|EU181295.1| [158266505]

196: EU181294
Homo sapiens isolate Ph23K control region, partial sequence; mitochondrial
gi|158266504|gb|EU181294.1| [158266504]

197: EU181293
Homo sapiens isolate Ph3K control region, partial sequence; mitochondrial
gi|158266503|gb|EU181293.1| [158266503]

198: EU181292
Homo sapiens isolate Ph5K control region, partial sequence; mitochondrial
gi|158266502|gb|EU181292.1| [158266502]

199: EU181291
Homo sapiens isolate pH18E control region, partial sequence; mitochondrial
gi|158266501|gb|EU181291.1| [158266501]

200: EU181290
Homo sapiens isolate pH1E control region, partial sequence; mitochondrial
gi|158266500|gb|EU181290.1| [158266500]

201: EU181289
Homo sapiens isolate pH8E control region, partial sequence; mitochondrial
gi|158266499|gb|EU181289.1| [158266499]

202: EU181288
Homo sapiens isolate Ph3aE control region, partial sequence; mitochondrial
gi|158266498|gb|EU181288.1| [158266498]

203: EU181287
Homo sapiens isolate pH4E control region, partial sequence; mitochondrial
gi|158266497|gb|EU181287.1| [158266497]

204: EU181286
Homo sapiens isolate pH5E control region, partial sequence; mitochondrial
gi|158266496|gb|EU181286.1| [158266496]

205: EU181285
Homo sapiens isolate pH3E control region, partial sequence; mitochondrial
gi|158266495|gb|EU181285.1| [158266495]

206: EU181284
Homo sapiens isolate pH22E control region, partial sequence; mitochondrial
gi|158266494|gb|EU181284.1| [158266494]

207: EU181283
Homo sapiens isolate pHE control region, partial sequence; mitochondrial
gi|158266493|gb|EU181283.1| [158266493]

208: EU181282
Homo sapiens isolate Ar38 control region, partial sequence; mitochondrial
gi|158266492|gb|EU181282.1| [158266492]

209: EU181281
Homo sapiens isolate Ar2a control region, partial sequence; mitochondrial
gi|158266491|gb|EU181281.1| [158266491]

210: EU181280
Homo sapiens isolate Ar22b control region, partial sequence; mitochondrial
gi|158266490|gb|EU181280.1| [158266490]

211: EU181279
Homo sapiens isolate Ar22a control region, partial sequence; mitochondrial
gi|158266489|gb|EU181279.1| [158266489]

212: EU181278
Homo sapiens isolate Ar2 control region, partial sequence; mitochondrial
gi|158266488|gb|EU181278.1| [158266488]

213: EU181277
Homo sapiens isolate Ar67 control region, partial sequence; mitochondrial
gi|158266487|gb|EU181277.1| [158266487]

214: EU181276
Homo sapiens isolate Ar20 control region, partial sequence; mitochondrial
gi|158266486|gb|EU181276.1| [158266486]

215: EU181275
Homo sapiens isolate Ar26 control region, partial sequence; mitochondrial
gi|158266485|gb|EU181275.1| [158266485]

216: EU181274
Homo sapiens isolate Ar85 control region, partial sequence; mitochondrial
gi|158266484|gb|EU181274.1| [158266484]

217: EU181273
Homo sapiens isolate Ar74 control region, partial sequence; mitochondrial
gi|158266483|gb|EU181273.1| [158266483]

218: EU181272
Homo sapiens isolate Ar9Ah2 control region, partial sequence; mitochondrial
gi|158266482|gb|EU181272.1| [158266482]

219: EU181271
Homo sapiens isolate Ar68 control region, partial sequence; mitochondrial
gi|158266481|gb|EU181271.1| [158266481]

220: EU181270
Homo sapiens isolate Ar58 control region, partial sequence; mitochondrial
gi|158266480|gb|EU181270.1| [158266480]

221: EU181269
Homo sapiens isolate Ar53 control region, partial sequence; mitochondrial
gi|158266479|gb|EU181269.1| [158266479]

222: EU181268
Homo sapiens isolate Ar28 control region, partial sequence; mitochondrial
gi|158266478|gb|EU181268.1| [158266478]

223: EU181267
Homo sapiens isolate Ar42 control region, partial sequence; mitochondrial
gi|158266477|gb|EU181267.1| [158266477]

224: EU181266
Homo sapiens isolate Ar56 control region, partial sequence; mitochondrial
gi|158266476|gb|EU181266.1| [158266476]

225: DQ900749
Homo sapiens isolate TW7 control region, partial sequence; mitochondrial
gi|114224783|gb|DQ900749.1| [114224783]

226: DQ900748
Homo sapiens isolate KPLN1 control region, partial sequence; mitochondrial
gi|114224782|gb|DQ900748.1| [114224782]

227: DQ900747
Homo sapiens isolate PBOH2 control region, partial sequence; mitochondrial
gi|114224781|gb|DQ900747.1| [114224781]

228: DQ900746
Homo sapiens isolate KU9 control region, partial sequence; mitochondrial
gi|114224780|gb|DQ900746.1| [114224780]

229: DQ900745
Homo sapiens isolate P04 control region, partial sequence; mitochondrial
gi|114224779|gb|DQ900745.1| [114224779]

230: DQ900744
Homo sapiens isolate P001 control region, partial sequence; mitochondrial
gi|114224778|gb|DQ900744.1| [114224778]

231: DQ900743
Homo sapiens isolate KU61 control region, partial sequence; mitochondrial
gi|114224777|gb|DQ900743.1| [114224777]

232: DQ900742
Homo sapiens isolate KU60 control region, partial sequence; mitochondrial
gi|114224776|gb|DQ900742.1| [114224776]

233: AY203963
Homo sapiens clone 2 type II hair keratin gene, partial cds
gi|37781622|gb|AY203963.1| [37781622]

234: AY037552
Homo sapiens clone 1 type II hair-specific keratin (KRTHB6) gene, promoter region and partial cds
gi|21307735|gb|AY037552.1| [21307735]

235: DQ200830
Homo sapiens isolate 35T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862246|gb|DQ200830.1| [77862246]

236: DQ200829
Homo sapiens isolate 35N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862245|gb|DQ200829.1| [77862245]

237: DQ200828
Homo sapiens isolate 60T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862244|gb|DQ200828.1| [77862244]

238: DQ200827
Homo sapiens isolate 60N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862243|gb|DQ200827.1| [77862243]

239: DQ200826
Homo sapiens isolate 14T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862242|gb|DQ200826.1| [77862242]

240: DQ200825
Homo sapiens isolate 14N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862241|gb|DQ200825.1| [77862241]

241: DQ200824
Homo sapiens isolate 41T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862240|gb|DQ200824.1| [77862240]

242: DQ200823
Homo sapiens isolate 41N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862239|gb|DQ200823.1| [77862239]

243: DQ200822
Homo sapiens isolate 46-TUMOR-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862238|gb|DQ200822.1| [77862238]

244: DQ200821
Homo sapiens isolate 45-NORMAL-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862237|gb|DQ200821.1| [77862237]

245: DQ200820
Homo sapiens isolate 58T-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862236|gb|DQ200820.1| [77862236]

246: DQ200819
Homo sapiens isolate 58N-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862235|gb|DQ200819.1| [77862235]

247: DQ200818
Homo sapiens isolate K50-TUMOR-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862234|gb|DQ200818.1| [77862234]

248: DQ200817
Homo sapiens isolate K49-NORMAL-HVR1-NORTH control region, partial sequence; mitochondrial
gi|77862233|gb|DQ200817.1| [77862233]

249: DQ143207
Homo sapiens isolate 37-T-HVR2-Kashmir control region, partial sequence; mitochondrial
gi|75678082|gb|DQ143207.1| [75678082]

250: DQ143206
Homo sapiens isolate 37-N-HVR2-Kashmir control region, partial sequence; mitochondrial
gi|75678081|gb|DQ143206.1| [75678081]

251: DQ143205
Homo sapiens isolate 32-T-HVR2-Kashmir control region, partial sequence; mitochondrial
gi|75678080|gb|DQ143205.1| [75678080]

252: DQ143204
Homo sapiens isolate 32-N-HVR2-Kashmir control region, partial sequence; mitochondrial
gi|75678079|gb|DQ143204.1| [75678079]

253: DQ143203
Homo sapiens isolate 21-T-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678078|gb|DQ143203.1| [75678078]

254: DQ143202
Homo sapiens isolate 21-N-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678077|gb|DQ143202.1| [75678077]

255: DQ143201
Homo sapiens isolate 13-T-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678076|gb|DQ143201.1| [75678076]

256: DQ143200
Homo sapiens isolate 13-N-Hvr2-Delhi control region, partial sequence; mitochondrial
gi|75678075|gb|DQ143200.1| [75678075]

257: DQ143199
Homo sapiens isolate 19-T-Hvr2-Delhi control region, partial sequence; mitochondrial
gi|75678074|gb|DQ143199.1| [75678074]

258: DQ143198
Homo sapiens isolate 19-N-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678073|gb|DQ143198.1| [75678073]

259: DQ143197
Homo sapiens isolate 5-T-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678072|gb|DQ143197.1| [75678072]

260: DQ143196
Homo sapiens isolate 5-N-HVR2-Delhi control region, partial sequence; mitochondrial
gi|75678071|gb|DQ143196.1| [75678071]

261: DQ143195
Homo sapiens isolate 30-T-Kashmir-HVR1 control region, partial sequence; mitochondrial
gi|75678070|gb|DQ143195.1| [75678070]

262: DQ143194
Homo sapiens isolate 30-N-Kashmir-HVR1 control region, partial sequence; mitochondrial
gi|75678069|gb|DQ143194.1| [75678069]

263: DQ143193
Homo sapiens isolate 25-T-Kashmir-HVR1 control region, partial sequence; mitochondrial
gi|75678068|gb|DQ143193.1| [75678068]

264: DQ143192
Homo sapiens isolate 25-N-Kashmir-HVR1 control region, partial sequence; mitochondrial
gi|75678067|gb|DQ143192.1| [75678067]

265: DQ143191
Homo sapiens isolate 31-T-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678066|gb|DQ143191.1| [75678066]

266: DQ143190
Homo sapiens isolate 31-N-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678065|gb|DQ143190.1| [75678065]

267: DQ143189
Homo sapiens isolate 7-T-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678064|gb|DQ143189.1| [75678064]

268: DQ143188
Homo sapiens isolate 7-N-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678063|gb|DQ143188.1| [75678063]

269: DQ143187
Homo sapiens isolate 5-T-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678062|gb|DQ143187.1| [75678062]

270: DQ143186
Homo sapiens isolate 5-N-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678061|gb|DQ143186.1| [75678061]

271: DQ143185
Homo sapiens isolate 3-T-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678060|gb|DQ143185.1| [75678060]

272: DQ143184
Homo sapiens isolate 3-N-Delhi-HVR1 control region, partial sequence; mitochondrial
gi|75678059|gb|DQ143184.1| [75678059]

273: DQ233635
Homo sapiens chromosome 16 from India genomic sequence
gi|78100381|gb|DQ233635.1| [78100381]

274: AF242584
Homo sapiens pyruvate kinase M2 gene, partial cds
gi|7649148|gb|AF242584.1| [7649148]

275: AF185280
Homo sapiens pyruvate kinase M2 gene, partial cds
gi|6018095|gb|AF185280.1| [6018095]

276: AF157693
Homo sapiens frameshifted pyruvate kinase M2 gene, partial cds
gi|5702303|gb|AF157693.1| [5702303]

277: AY899194
Homo sapiens clone UHC139 control region, partial sequence; mitochondrial
gi|58702602|gb|AY899194.1| [58702602]

278: AY899193
Homo sapiens clone UD50 control region, partial sequence; mitochondrial
gi|58702590|gb|AY899193.1| [58702590]

279: AY899192
Homo sapiens clone UD47 control region, partial sequence; mitochondrial
gi|58702566|gb|AY899192.1| [58702566]

280: AY899191
Homo sapiens clone SST4 control region, partial sequence; mitochondrial
gi|58702548|gb|AY899191.1| [58702548]

281: AY899190
Homo sapiens clone S18 control region, partial sequence; mitochondrial
gi|58702515|gb|AY899190.1| [58702515]

282: AY899189
Homo sapiens clone PSUR control region, partial sequence; mitochondrial
gi|58702495|gb|AY899189.1| [58702495]

283: AY899188
Homo sapiens clone PP76 control region, partial sequence; mitochondrial
gi|58702475|gb|AY899188.1| [58702475]

284: AY899187
Homo sapiens clone PP70 control region, partial sequence; mitochondrial
gi|58702453|gb|AY899187.1| [58702453]

285: AY899186
Homo sapiens clone PP64 control region, partial sequence; mitochondrial
gi|58702435|gb|AY899186.1| [58702435]

286: AY899185
Homo sapiens clone BVIJ control region, partial sequence; mitochondrial
gi|58702414|gb|AY899185.1| [58702414]

287: AY899184
Homo sapiens clone BHC27 control region, partial sequence; mitochondrial
gi|58702387|gb|AY899184.1| [58702387]

288: AY899183
Homo sapiens clone BHC156 control region, partial sequence; mitochondrial
gi|58702372|gb|AY899183.1| [58702372]

289: AY899182
Homo sapiens clone B16 control region, partial sequence; mitochondrial
gi|58702355|gb|AY899182.1| [58702355]

290: AY642023
Homo sapiens clone up64 HVRII control region, partial sequence; mitochondrial
gi|50956620|gb|AY642023.1| [50956620]

291: AY642022
Homo sapiens clone up41 HVRII control region, partial sequence; mitochondrial
gi|50956619|gb|AY642022.1| [50956619]

292: AY642021
Homo sapiens clone pb57 HVRII control region, partial sequence; mitochondrial
gi|50956618|gb|AY642021.1| [50956618]

293: AY642020
Homo sapiens clone si153 HVRII control region, partial sequence; mitochondrial
gi|50956617|gb|AY642020.1| [50956617]

294: AY642019
Homo sapiens clone bi57 HVRII control region, partial sequence; mitochondrial
gi|50956616|gb|AY642019.1| [50956616]

295: AY642018
Homo sapiens clone up70 HVRII control region, partial sequence; mitochondrial
gi|50956615|gb|AY642018.1| [50956615]

296: AY642017
Homo sapiens clone bi31 HVRII control region, partial sequence; mitochondrial
gi|50956614|gb|AY642017.1| [50956614]

297: AY642016
Homo sapiens clone pb19 HVRII control region, partial sequence; mitochondrial
gi|50956613|gb|AY642016.1| [50956613]

298: AY642015
Homo sapiens clone pb15 HVRII control region, partial sequence; mitochondrial
gi|50956612|gb|AY642015.1| [50956612]

299: AY642014
Homo sapiens clone si103 HVRII control region, partial sequence; mitochondrial
gi|50956611|gb|AY642014.1| [50956611]

300: AY642013
Homo sapiens clone si23 HVRII control region, partial sequence; mitochondrial
gi|50956610|gb|AY642013.1| [50956610]

301: AY642012
Homo sapiens clone upD4 HVRII control region, partial sequence; mitochondrial
gi|50956609|gb|AY642012.1| [50956609]

302: AY642011
Homo sapiens clone up75 HVRII control region, partial sequence; mitochondrial
gi|50956608|gb|AY642011.1| [50956608]

303: AY642010
Homo sapiens clone up49 HVRII control region, partial sequence; mitochondrial
gi|50956607|gb|AY642010.1| [50956607]

304: AY642009
Homo sapiens clone pb36 HVRII control region, partial sequence; mitochondrial
gi|50956606|gb|AY642009.1| [50956606]

305: AY642008
Homo sapiens clone si28 HVRII control region, partial sequence; mitochondrial
gi|50956605|gb|AY642008.1| [50956605]

306: AY642007
Homo sapiens clone si24 HVRII control region, partial sequence; mitochondrial
gi|50956604|gb|AY642007.1| [50956604]

307: AY642006
Homo sapiens clone bi55 HVRII control region, partial sequence; mitochondrial
gi|50956603|gb|AY642006.1| [50956603]

308: AY642005
Homo sapiens clone bi27 HVRII control region, partial sequence; mitochondrial
gi|50956602|gb|AY642005.1| [50956602]

309: AY642004
Homo sapiens clone bi13 HVRII control region, partial sequence; mitochondrial
gi|50956601|gb|AY642004.1| [50956601]

310: AY642003
Homo sapiens clone bi91 HVRII control region, partial sequence; mitochondrial
gi|50956600|gb|AY642003.1| [50956600]

311: AY642002
Homo sapiens clone bi72 HVRII control region, partial sequence; mitochondrial
gi|50956599|gb|AY642002.1| [50956599]

312: AY642001
Homo sapiens clone bi61 HVRII control region, partial sequence; mitochondrial
gi|50956598|gb|AY642001.1| [50956598]

313: AY642000
Homo sapiens clone bi48 HVRII control region, partial sequence; mitochondrial
gi|50956597|gb|AY642000.1| [50956597]

314: AF542198
Homo sapiens clone ASB MT-Vibs mitochondrial control region, partial sequence
gi|23344702|gb|AF542198.1| [23344702]

315: AF542197
Homo sapiens clone ASB MT-70 mitochondrial control region, partial sequence
gi|23344701|gb|AF542197.1| [23344701]

316: AF542196
Homo sapiens clone ASB MT-63 mitochondrial control region, partial sequence
gi|23344700|gb|AF542196.1| [23344700]

317: AF542195
Homo sapiens clone ASB MT-49 mitochondrial control region, partial sequence
gi|23344699|gb|AF542195.1| [23344699]

318: AF542194
Homo sapiens clone ASB MT-7 mitochondrial control region, partial sequence
gi|23344698|gb|AF542194.1| [23344698]

319: AF542193
Homo sapiens clone ASB MT-ST10 mitochondrial control region, partial sequence
gi|23344697|gb|AF542193.1| [23344697]

320: AF542192
Homo sapiens clone ASB MT-30 mitochondrial control region, partial sequence
gi|23344696|gb|AF542192.1| [23344696]

321: AF467450
Homo sapiens clone ASB MT-16 mitochondrial control region, partial sequence
gi|18448911|gb|AF467450.1| [18448911]

322: AF467449
Homo sapiens clone ASB MT-19 mitochondrial control region, partial sequence
gi|18448910|gb|AF467449.1| [18448910]

323: AF467448
Homo sapiens clone ASB MT-10 mitochondrial control region, partial sequence
gi|18448909|gb|AF467448.1| [18448909]

324: AF467447
Homo sapiens clone ASB MT-9a mitochondrial control region, partial sequence
gi|18448908|gb|AF467447.1| [18448908]

325: AF467446
Homo sapiens clone ASB MT-13 mitochondrial control region, partial sequence
gi|18448907|gb|AF467446.1| [18448907]

326: AF467445
Homo sapiens clone ASB MT-6 mitochondrial control region, partial sequence
gi|18448906|gb|AF467445.1| [18448906]

327: DQ176764
Homo sapiens isolate UB31 control region, partial sequence; mitochondrial
gi|74273800|gb|DQ176764.1| [74273800]

328: DQ176763
Homo sapiens isolate MMB46 control region, partial sequence; mitochondrial
gi|74273799|gb|DQ176763.1| [74273799]

329: DQ176762
Homo sapiens isolate GB26 control region, partial sequence; mitochondrial
gi|74273798|gb|DQ176762.1| [74273798]

330: DQ176761
Homo sapiens isolate GB14 control region, partial sequence; mitochondrial
gi|74273797|gb|DQ176761.1| [74273797]

331: DQ176760
Homo sapiens isolate 43 control region, partial sequence; mitochondrial
gi|74273699|gb|DQ176760.1| [74273699]

332: DQ176759
Homo sapiens isolate 34n control region, partial sequence; mitochondrial
gi|74273698|gb|DQ176759.1| [74273698]

333: DQ176758
Homo sapiens isolate 29 control region, partial sequence; mitochondrial
gi|74273697|gb|DQ176758.1| [74273697]

334: DQ176757
Homo sapiens isolate 27n control region, partial sequence; mitochondrial
gi|74273696|gb|DQ176757.1| [74273696]

335: AF378194
Homo sapiens clone 6 interferon gamma (IFNG) gene, intron 1
gi|20513848|gb|AF378194.1| [20513848]

336: AF378193
Homo sapiens clone 5 interferon gamma (IFNG) gene, intron 1
gi|20513847|gb|AF378193.1| [20513847]

337: AF378192
Homo sapiens clone 4 interferon gamma (IFNG) gene, intron 1
gi|20513846|gb|AF378192.1| [20513846]

338: AF378191
Homo sapiens clone 3 interferon gamma (IFNG) gene, intron 1
gi|20513845|gb|AF378191.1| [20513845]

339: AF378190
Homo sapiens clone 2 interferon gamma (IFNG) gene, intron 1
gi|20513844|gb|AF378190.1| [20513844]

340: AF378189
Homo sapiens clone 1 interferon gamma (IFNG) gene, intron 1
gi|20513843|gb|AF378189.1| [20513843]

341: AY613989
Homo sapiens interleukin 6 gene, promoter region and exon 1
gi|50428878|gb|AY613989.1| [50428878]

342: AY576688
Homo sapiens clone VLL transforming growth factor-beta 1 gene, exon 1 and partial cds
gi|50428876|gb|AY576688.1| [50428876]

343: AY576687
Homo sapiens clone VR transforming growth factor-beta 1 gene, exon 1 and partial cds
gi|50428874|gb|AY576687.1| [50428874]

344: AY577521
Homo sapiens Fas gene, exon 1 and 5' UTR
gi|50295648|gb|AY577521.1| [50295648]

345: AY576686
Homo sapiens interferon-gamma gene, promoter region
gi|50253999|gb|AY576686.1| [50253999]

346: AY642040
Homo sapiens clone kp74 HVRI control region, partial sequence; mitochondrial
gi|50919524|gb|AY642040.1| [50919524]

347: AY642039
Homo sapiens clone kp5 HVRI control region, partial sequence; mitochondrial
gi|50919523|gb|AY642039.1| [50919523]

348: AY642038
Homo sapiens clone kp7 HVRI control region, partial sequence; mitochondrial
gi|50919522|gb|AY642038.1| [50919522]

349: AY642037
Homo sapiens clone km22 HVRI control region, partial sequence; mitochondrial
gi|50919521|gb|AY642037.1| [50919521]

350: AY642036
Homo sapiens clone km83 HVRI control region, partial sequence; mitochondrial
gi|50919520|gb|AY642036.1| [50919520]

351: AY642035

Homo sapiens clone kp16 HVRI control region, partial sequence; mitochondrial
gi|50919519|gb|AY642035.1| [50919519]

352: AY642034
Homo sapiens clone kp49 HVRI control region, partial sequence; mitochondrial
gi|50919518|gb|AY642034.1| [50919518]

353: AY641999
Homo sapiens clone bi45 HVRII control region, partial sequence; mitochondrial
gi|50956596|gb|AY641999.1| [50956596]

354: AY641998
Homo sapiens clone bi10 HVRII control region, partial sequence; mitochondrial
gi|50956595|gb|AY641998.1| [50956595]

355: AY641997
Homo sapiens clone JKKM99 HVRII control region, partial sequence; mitochondrial
gi|50956594|gb|AY641997.1| [50956594]

356: AY641996
Homo sapiens clone JKMC10 HVRII control region, partial sequence; mitochondrial
gi|50956593|gb|AY641996.1| [50956593]

357: AY641995
Homo sapiens clone JKDN26 HVRII control region, partial sequence; mitochondrial
gi|50956592|gb|AY641995.1| [50956592]

358: AY641994
Homo sapiens clone JKR4 HVRI control region, partial sequence; mitochondrial
gi|50956591|gb|AY641994.1| [50956591]

359: AY641993
Homo sapiens clone JKSV15 HVRII control region, partial sequence; mitochondrial
gi|50956590|gb|AY641993.1| [50956590]

360: AY641992
Homo sapiens chromosome Y SRY4064 region genomic sequence
gi|50956589|gb|AY641992.1| [50956589]

361: AY642033
Homo sapiens clone JKSV14 HVRII control region, partial sequence; mitochondrial
gi|50919513|gb|AY642033.1| [50919513]

362: AY642032
Homo sapiens clone JKSV24 HVRII control region, partial sequence; mitochondrial
gi|50919512|gb|AY642032.1| [50919512]

363: AY642031
Homo sapiens clone JKKM32 HVRII control region, partial sequence; mitochondrial
gi|50919511|gb|AY642031.1| [50919511]

364: AY642030
Homo sapiens clone JKKM18 HVRII control region, partial sequence; mitochondrial
gi|50919510|gb|AY642030.1| [50919510]

365: AY642029
Homo sapiens clone JKKM62 HVRII control region, partial sequence; mitochondrial
gi|50919509|gb|AY642029.1| [50919509]

366: AY642028
Homo sapiens clone JKR148 HVRII control region, partial sequence; mitochondrial
gi|50919508|gb|AY642028.1| [50919508]

367: AY642027
Homo sapiens clone JKR114 HVRII control region, partial sequence; mitochondrial
gi|50919507|gb|AY642027.1| [50919507]

368: AY642026
Homo sapiens clone JKR126 HVRII control region, partial sequence; mitochondrial
gi|50919506|gb|AY642026.1| [50919506]

369: AY642025
Homo sapiens clone JKR131 HVRII control region, partial sequence; mitochondrial
gi|50919505|gb|AY642025.1| [50919505]

370: AY642024
Homo sapiens clone JKR116 HVRII control region, partial sequence; mitochondrial
gi|50919504|gb|AY642024.1| [50919504]

371: AY059373
Homo sapiens transforming growth factor beta 1 (TGFB1) gene, partial cds
gi|45602839|gb|AY059373.2| [45602839]

372: AF362378
Homo sapiens interleukin 6 (IL6) gene, promoter region and 5' untranslated region
gi|19481401|gb|AF362378.1| [19481401]

373: AY343912
Homo sapiens chromosome 17 map 17q21-23 unknown mRNA, partial sequence
gi|37813575|gb|AY343912.1| [37813575]

374: AY152545
Homo sapiens clone SK3 type II keratin (KRTHB6) gene, exon 7 and partial cds
gi|37722558|gb|AY152545.1| [37722558]

375: AY152544
Homo sapiens clone SK2 type II keratin (KRTHB6) gene, exon 7 and partial cds
gi|37722556|gb|AY152544.1| [37722556]

376: AY152543
Homo sapiens clone SK1 type II keratin (KRTHB6) gene, exon 7 and partial cds
gi|37722554|gb|AY152543.1| [37722554]

377: AY345602
Homo sapiens clone 2T microsatellite D17S379 sequence
gi|33590478|gb|AY345602.1| [33590478]

378: AY345601
Homo sapiens clone 1 microsatellite D17S379 sequence
gi|33590477|gb|AY345601.1| [33590477]

379: AY151039
Homo sapiens breast cancer susceptibility protein BRCA2 gene, exon 2 and partial cds
gi|23506222|gb|AY151039.1| [23506222]

380: AF542199
Homo sapiens clone ASB MT-53 mitochondrial control region, partial sequence
gi|23344703|gb|AF542199.1| [23344703]

381: AF416706
Homo sapiens hair-specific type II keratin protein (KRTHB6) gene, partial cds
gi|22725174|gb|AF416706.1| [22725174]

382: AF416705
Homo sapiens keratin protein HB6 (KRTHB6) gene, partial cds
gi|22725172|gb|AF416705.1| [22725172]

383: AY121753
Homo sapiens type II basic hair keratin (KRTHB1) gene, introns 6 and 7, exon 7 and partial cds
gi|22415732|gb|AY121753.1| [22415732]

384: AY123848
Homo sapiens type II hair-specific keratin (KRTHB1) gene, partial cds
gi|22212272|gb|AY123848.1| [22212272]

385: AF157691
Homo sapiens minisatellite sequence
gi|5702300|gb|AF157691.1|AF157691 [5702300]

386: AF079321
Homo sapiens chromosome 17 clone pCMM86 map 17q, sequence tagged site
gi|4106409|gb|AF079321.1|AF079321 [4106409]

387: AF201745
Homo sapiens minisatellite pbaML sequence
gi|6739819|gb|AF201745.1|AF201745 [6739819]

388: AF216940
Gavialis gangeticus minisatellite sequence
gi|6708483|gb|AF216940.1|AF216940 [6708483]

389: AF157692
Homo sapiens pyruvate kinase M2 gene, partial cds
gi|5702301|gb|AF157692.1|AF157692 [5702301]

PROTEINS

1: AAO63472

type II hair keratin [Homo sapiens]

gi|37781623|gb|AAO63472.1|[37781623]

2: AAF65764

pyruvate kinase M2 [Homo sapiens]

gi|7649149|gb|AAF65764.1|[7649149]

3: AAF01766

pyruvate kinase M2 [Homo sapiens]

gi|6018096|gb|AAF01766.1|[6018096]

4: AAD47249

frameshifted pyruvate kinase M2 [Homo sapiens]

gi|5702304|gb|AAD47249.1|[5702304]

5: AAL27646

transforming growth factor beta 1 [Homo sapiens]

gi|45602840|gb|AAL27646.2|[45602840]

6: ACF04131

cytochrome c oxidase subunit I [Homo sapiens]

gi|192335153|gb|ACF04131.1|[192335153]

7: AAK68688

type II hair-specific keratin [Homo sapiens]

gi|21307736|gb|AAK68688.1|[21307736]

8: AAT77144

transforming growth factor-beta 1 [Homo sapiens]

gi|50428877|gb|AAT77144.1|[50428877]

9: AAT77143

transforming growth factor-beta 1 [Homo sapiens]

gi|50428875|gb|AAT77143.1|[50428875]

10: AAN75227

type II keratin [Homo sapiens]

gi|37722559|gb|AAN75227.1|[37722559]

11: AAN75226

type II keratin [Homo sapiens]

gi|37722557|gb|AAN75226.1|[37722557]

12: AAN75225

type II keratin [Homo sapiens]

gi|37722555|gb|AAN75225.1|[37722555]

13: AAN28944

breast cancer susceptibility protein BRCA2 [Homo sapiens]

gi|23506223|gb|AAN28944.1|[23506223]

14: AAN04664

hair-specific type II keratin protein [Homo sapiens]

gi|22725175|gb|AAN04664.1|[22725175]

15: AAN04663

keratin protein HB6 [Homo sapiens]

gi|22725173|gb|AAN04663.1|[22725173]

16: AAM94951

type II basic hair keratin [Homo sapiens]

gi|22415733|gb|AAM94951.1|[22415733]

17: AAM92877

type II hair-specific keratin [Homo sapiens]

gi|22212273|gb|AAM92877.1|[22212273]

18: AAD47248

pyruvate kinase M2 [Homo sapiens]

gi|5702302|gb|AAD47248.1|[5702302]

19: ACF36065

cytochrome b [Homo sapiens]

gi|194268031|gb|ACF36065.1|[194268031]

20: ACF36064

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194268030|gb|ACF36064.1|[194268030]

21: ACF36063

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194268029|gb|ACF36063.1|[194268029]

22: ACF36062

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194268028|gb|ACF36062.1|[194268028]

23: ACF36061

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194268027|gb|ACF36061.1|[194268027]

24: ACF36060

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194268026|gb|ACF36060.1|[194268026]

25: ACF36059

cytochrome c oxidase subunit III [Homo sapiens]

gi|194268025|gb|ACF36059.1|[194268025]

26: ACF36058

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194268024|gb|ACF36058.1|[194268024]

27: ACF36057

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194268023|gb|ACF36057.1|[194268023]

28: ACF36056

cytochrome c oxidase subunit II [Homo sapiens]

gi|194268022|gb|ACF36056.1|[194268022]

29: ACF36055

cytochrome c oxidase subunit I [Homo sapiens]

gi|194268021|gb|ACF36055.1|[194268021]

30: ACF36054

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194268020|gb|ACF36054.1|[194268020]

31: ACF36053

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194268019|gb|ACF36053.1|[194268019]

32: ACF36052

cytochrome b [Homo sapiens]

gi|194268017|gb|ACF36052.1|[194268017]

33: ACF36051

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194268016|gb|ACF36051.1|[194268016]

34: ACF36050

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194268015|gb|ACF36050.1|[194268015]

35: ACF36049

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194268014|gb|ACF36049.1|[194268014]

36: ACF36048

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194268013|gb|ACF36048.1|[194268013]

37: ACF36047

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194268012|gb|ACF36047.1|[194268012]

38: ACF36046

cytochrome c oxidase subunit III [Homo sapiens]

gi|194268011|gb|ACF36046.1|[194268011]

39: ACF36045

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194268010|gb|ACF36045.1|[194268010]

40: ACF36044

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194268009|gb|ACF36044.1|[194268009]

41: ACF36043

cytochrome c oxidase subunit II [Homo sapiens]

gi|194268008|gb|ACF36043.1|[194268008]

42: ACF36042

cytochrome c oxidase subunit I [Homo sapiens]

gi|194268007|gb|ACF36042.1|[194268007]

43: ACF36041

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194268006|gb|ACF36041.1|[194268006]

44: ACF36040

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194268005|gb|ACF36040.1|[194268005]

45: ACF36039

cytochrome b [Homo sapiens]

gi|194268003|gb|ACF36039.1|[194268003]

46: ACF36038

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194268002|gb|ACF36038.1|[194268002]

47: ACF36037

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194268001|gb|ACF36037.1|[194268001]

48: ACF36036

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194268000|gb|ACF36036.1|[194268000]

49: ACF36035

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267999|gb|ACF36035.1|[194267999]

50: ACF36034

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267998|gb|ACF36034.1|[194267998]

51: ACF36033

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267997|gb|ACF36033.1|[194267997]

52: ACF36032

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267996|gb|ACF36032.1|[194267996]

53: ACF36031

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267995|gb|ACF36031.1|[194267995]

54: ACF36030

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267994|gb|ACF36030.1|[194267994]

55: ACF36029

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267993|gb|ACF36029.1|[194267993]

56: ACF36028

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267992|gb|ACF36028.1|[194267992]

57: ACF36027

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267991|gb|ACF36027.1|[194267991]

58: ACF36026

cytochrome b [Homo sapiens]

gi|194267989|gb|ACF36026.1|[194267989]

59: ACF36025

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267988|gb|ACF36025.1|[194267988]

60: ACF36024

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267987|gb|ACF36024.1|[194267987]

61: ACF36023

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267986|gb|ACF36023.1|[194267986]

62: ACF36022

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267985|gb|ACF36022.1|[194267985]

63: ACF36021

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267984|gb|ACF36021.1|[194267984]

64: ACF36020

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267983|gb|ACF36020.1|[194267983]

65: ACF36019

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267982|gb|ACF36019.1|[194267982]

66: ACF36018

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267981|gb|ACF36018.1|[194267981]

67: ACF36017

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267980|gb|ACF36017.1|[194267980]

68: ACF36016

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267979|gb|ACF36016.1|[194267979]

69: ACF36015

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267978|gb|ACF36015.1|[194267978]

 

70: ACF36014

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267977|gb|ACF36014.1|[194267977]

71: ACF36013

cytochrome b [Homo sapiens]

gi|194267975|gb|ACF36013.1|[194267975]

72: ACF36012

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267974|gb|ACF36012.1|[194267974]

73: ACF36011

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267973|gb|ACF36011.1|[194267973]

74: ACF36010

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267972|gb|ACF36010.1|[194267972]

75: ACF36009

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267971|gb|ACF36009.1|[194267971]

76: ACF36008

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267970|gb|ACF36008.1|[194267970]

77: ACF36007

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267969|gb|ACF36007.1|[194267969]

78: ACF36006

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267968|gb|ACF36006.1|[194267968]

79: ACF36005

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267967|gb|ACF36005.1|[194267967]

80: ACF36004

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267966|gb|ACF36004.1|[194267966]

81: ACF36003

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267965|gb|ACF36003.1|[194267965]

82: ACF36002

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267964|gb|ACF36002.1|[194267964]

83: ACF36001

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267963|gb|ACF36001.1|[194267963]

84: ACF36000

cytochrome b [Homo sapiens]

gi|194267961|gb|ACF36000.1|[194267961]

85: ACF35999

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267960|gb|ACF35999.1|[194267960]

86: ACF35998

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267959|gb|ACF35998.1|[194267959]

87: ACF35997

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267958|gb|ACF35997.1|[194267958]

88: ACF35996

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267957|gb|ACF35996.1|[194267957]

89: ACF35995

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267956|gb|ACF35995.1|[194267956]

90: ACF35994

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267955|gb|ACF35994.1|[194267955]

91: ACF35993

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267954|gb|ACF35993.1|[194267954]

92: ACF35992

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267953|gb|ACF35992.1|[194267953]

93: ACF35991

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267952|gb|ACF35991.1|[194267952]

94: ACF35990

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267951|gb|ACF35990.1|[194267951]

95: ACF35989

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267950|gb|ACF35989.1|[194267950]

96: ACF35988

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267949|gb|ACF35988.1|[194267949]

97: ACF35987

cytochrome b [Homo sapiens]

gi|194267947|gb|ACF35987.1|[194267947]

98: ACF35986

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267946|gb|ACF35986.1|[194267946]

99: ACF35985

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267945|gb|ACF35985.1|[194267945]

100: ACF35984

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267944|gb|ACF35984.1|[194267944]

101: ACF35983

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267943|gb|ACF35983.1|[194267943]

102: ACF35982

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267942|gb|ACF35982.1|[194267942]

103: ACF35981

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267941|gb|ACF35981.1|[194267941]

104: ACF35980

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267940|gb|ACF35980.1|[194267940]

105: ACF35979

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267939|gb|ACF35979.1|[194267939]

106: ACF35978

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267938|gb|ACF35978.1|[194267938]

107: ACF35977

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267937|gb|ACF35977.1|[194267937]

108: ACF35976

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267936|gb|ACF35976.1|[194267936]

109: ACF35975

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267935|gb|ACF35975.1|[194267935]

110: ACF35974

cytochrome b [Homo sapiens]

gi|194267933|gb|ACF35974.1|[194267933]

111: ACF35973

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267932|gb|ACF35973.1|[194267932]

112: ACF35972

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267931|gb|ACF35972.1|[194267931]

113: ACF35971

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267930|gb|ACF35971.1|[194267930]

114: ACF35970

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267929|gb|ACF35970.1|[194267929]

115: ACF35969

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267928|gb|ACF35969.1|[194267928]

116: ACF35968

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267927|gb|ACF35968.1|[194267927]

117: ACF35967

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267926|gb|ACF35967.1|[194267926]

118: ACF35966

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267925|gb|ACF35966.1|[194267925]

119: ACF35965

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267924|gb|ACF35965.1|[194267924]

120: ACF35964

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267923|gb|ACF35964.1|[194267923]

121: ACF35963

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267922|gb|ACF35963.1|[194267922]

122: ACF35962

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267921|gb|ACF35962.1|[194267921]

123: ACF35961

cytochrome b [Homo sapiens]

gi|194267919|gb|ACF35961.1|[194267919]

124: ACF35960

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267918|gb|ACF35960.1|[194267918]

125: ACF35959

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267917|gb|ACF35959.1|[194267917]

126: ACF35958

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267916|gb|ACF35958.1|[194267916]

127: ACF35957

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267915|gb|ACF35957.1|[194267915]

128: ACF35956

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267914|gb|ACF35956.1|[194267914]

129: ACF35955

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267913|gb|ACF35955.1|[194267913]

130: ACF35954

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267912|gb|ACF35954.1|[194267912]

131: ACF35953

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267911|gb|ACF35953.1|[194267911]

132: ACF35952

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267910|gb|ACF35952.1|[194267910]

133: ACF35951

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267909|gb|ACF35951.1|[194267909]

134: ACF35950

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267908|gb|ACF35950.1|[194267908]

135: ACF35949

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267907|gb|ACF35949.1|[194267907]

136: ACF35948

cytochrome b [Homo sapiens]

gi|194267905|gb|ACF35948.1|[194267905]

137: ACF35947

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267904|gb|ACF35947.1|[194267904]

138: ACF35946

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267903|gb|ACF35946.1|[194267903]

139: ACF35945

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267902|gb|ACF35945.1|[194267902]

140: ACF35944

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267901|gb|ACF35944.1|[194267901]

141: ACF35943

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267900|gb|ACF35943.1|[194267900]

142: ACF35942

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267899|gb|ACF35942.1|[194267899]

143: ACF35941

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267898|gb|ACF35941.1|[194267898]

144: ACF35940

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267897|gb|ACF35940.1|[194267897]

145: ACF35939

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267896|gb|ACF35939.1|[194267896]

146: ACF35938

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267895|gb|ACF35938.1|[194267895]

147: ACF35937

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267894|gb|ACF35937.1|[194267894]

148: ACF35936

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267893|gb|ACF35936.1|[194267893]

149: ACF35935

cytochrome b [Homo sapiens]

gi|194267891|gb|ACF35935.1|[194267891]

150: ACF35934

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267890|gb|ACF35934.1|[194267890]

151: ACF35933

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267889|gb|ACF35933.1|[194267889]

152: ACF35932

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267888|gb|ACF35932.1|[194267888]

153: ACF35931

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267887|gb|ACF35931.1|[194267887]

154: ACF35930

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267886|gb|ACF35930.1|[194267886]

155: ACF35929

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267885|gb|ACF35929.1|[194267885]

156: ACF35928

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267884|gb|ACF35928.1|[194267884]

157: ACF35927

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267883|gb|ACF35927.1|[194267883]

158: ACF35926

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267882|gb|ACF35926.1|[194267882]

159: ACF35925

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267881|gb|ACF35925.1|[194267881]

160: ACF35924

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267880|gb|ACF35924.1|[194267880]

161: ACF35923

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267879|gb|ACF35923.1|[194267879]

162: ACF35922

cytochrome b [Homo sapiens]

gi|194267877|gb|ACF35922.1|[194267877]

163: ACF35921

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267876|gb|ACF35921.1|[194267876]

164: ACF35920

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267875|gb|ACF35920.1|[194267875]

165: ACF35919

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267874|gb|ACF35919.1|[194267874]

166: ACF35918

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267873|gb|ACF35918.1|[194267873]

167: ACF35917

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267872|gb|ACF35917.1|[194267872]

168: ACF35916

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267871|gb|ACF35916.1|[194267871]

169: ACF35915

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267870|gb|ACF35915.1|[194267870]

170: ACF35914

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267869|gb|ACF35914.1|[194267869]

171: ACF35913

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267868|gb|ACF35913.1|[194267868]

172: ACF35912

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267867|gb|ACF35912.1|[194267867]

173: ACF35911

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267866|gb|ACF35911.1|[194267866]

174: ACF35910

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267865|gb|ACF35910.1|[194267865]

175: ACF35909

cytochrome b [Homo sapiens]

gi|194267863|gb|ACF35909.1|[194267863]

176: ACF35908

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267862|gb|ACF35908.1|[194267862]

177: ACF35907

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267861|gb|ACF35907.1|[194267861]

178: ACF35906

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267860|gb|ACF35906.1|[194267860]

179: ACF35905

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267859|gb|ACF35905.1|[194267859]

180: ACF35904

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267858|gb|ACF35904.1|[194267858]

181: ACF35903

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267857|gb|ACF35903.1|[194267857]

182: ACF35902

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267856|gb|ACF35902.1|[194267856]

183: ACF35901

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267855|gb|ACF35901.1|[194267855]

184: ACF35900

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267854|gb|ACF35900.1|[194267854]

185: ACF35899

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267853|gb|ACF35899.1|[194267853]

186: ACF35898

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267852|gb|ACF35898.1|[194267852]

187: ACF35897

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267851|gb|ACF35897.1|[194267851]

188: ACF35896

cytochrome b [Homo sapiens]

gi|194267849|gb|ACF35896.1|[194267849]

189: ACF35895

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267848|gb|ACF35895.1|[194267848]

190: ACF35894

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267847|gb|ACF35894.1|[194267847]

191: ACF35893

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267846|gb|ACF35893.1|[194267846]

192: ACF35892

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267845|gb|ACF35892.1|[194267845]

193: ACF35891

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267844|gb|ACF35891.1|[194267844]

194: ACF35890

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267843|gb|ACF35890.1|[194267843]

195: ACF35889

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267842|gb|ACF35889.1|[194267842]

196: ACF35888

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267841|gb|ACF35888.1|[194267841]

197: ACF35887

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267840|gb|ACF35887.1|[194267840]

198: ACF35886

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267839|gb|ACF35886.1|[194267839]

199: ACF35885

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267838|gb|ACF35885.1|[194267838]

200: ACF35884

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267837|gb|ACF35884.1|[194267837]

201: ACF35883

cytochrome b [Homo sapiens]

gi|194267835|gb|ACF35883.1|[194267835]

202: ACF35882

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267834|gb|ACF35882.1|[194267834]

203: ACF35881

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267833|gb|ACF35881.1|[194267833]

204: ACF35880

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267832|gb|ACF35880.1|[194267832]

205: ACF35879

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267831|gb|ACF35879.1|[194267831]

206: ACF35878

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267830|gb|ACF35878.1|[194267830]

207: ACF35877

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267829|gb|ACF35877.1|[194267829]

208: ACF35876

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267828|gb|ACF35876.1|[194267828]

209: ACF35875

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267827|gb|ACF35875.1|[194267827]

210: ACF35874

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267826|gb|ACF35874.1|[194267826]

211: ACF35873

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267825|gb|ACF35873.1|[194267825]

212: ACF35872

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267824|gb|ACF35872.1|[194267824]

213: ACF35871

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267823|gb|ACF35871.1|[194267823]

214: ACF35870

cytochrome b [Homo sapiens]

gi|194267821|gb|ACF35870.1|[194267821]

215: ACF35869

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267820|gb|ACF35869.1|[194267820]

216: ACF35868

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267819|gb|ACF35868.1|[194267819]

217: ACF35867

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267818|gb|ACF35867.1|[194267818]

218: ACF35866

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267817|gb|ACF35866.1|[194267817]

219: ACF35865

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267816|gb|ACF35865.1|[194267816]

220: ACF35864

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267815|gb|ACF35864.1|[194267815]

221: ACF35863

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267814|gb|ACF35863.1|[194267814]

222: ACF35862

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267813|gb|ACF35862.1|[194267813]

223: ACF35861

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267812|gb|ACF35861.1|[194267812]

224: ACF35860

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267811|gb|ACF35860.1|[194267811]

225: ACF35859

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267810|gb|ACF35859.1|[194267810]

226: ACF35858

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267809|gb|ACF35858.1|[194267809]

227: ACF35857

cytochrome b [Homo sapiens]

gi|194267807|gb|ACF35857.1|[194267807]

228: ACF35856

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267806|gb|ACF35856.1|[194267806]

229: ACF35855

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267805|gb|ACF35855.1|[194267805]

230: ACF35854

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267804|gb|ACF35854.1|[194267804]

231: ACF35853

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267803|gb|ACF35853.1|[194267803]

232: ACF35852

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267802|gb|ACF35852.1|[194267802]

233: ACF35851

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267801|gb|ACF35851.1|[194267801]

234: ACF35850

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267800|gb|ACF35850.1|[194267800]

235: ACF35849

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267799|gb|ACF35849.1|[194267799]

236: ACF35848

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267798|gb|ACF35848.1|[194267798]

237: ACF35847

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267797|gb|ACF35847.1|[194267797]

238: ACF35846

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267796|gb|ACF35846.1|[194267796]

239: ACF35845

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267795|gb|ACF35845.1|[194267795]

240: ACF35844

cytochrome b [Homo sapiens]

gi|194267793|gb|ACF35844.1|[194267793]

241: ACF35843

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267792|gb|ACF35843.1|[194267792]

242: ACF35842

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267791|gb|ACF35842.1|[194267791]

243: ACF35841

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267790|gb|ACF35841.1|[194267790]

244: ACF35840

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267789|gb|ACF35840.1|[194267789]

245: ACF35839

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267788|gb|ACF35839.1|[194267788]

246: ACF35838

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267787|gb|ACF35838.1|[194267787]

247: ACF35837

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267786|gb|ACF35837.1|[194267786]

248: ACF35836

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267785|gb|ACF35836.1|[194267785]

249: ACF35835

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267784|gb|ACF35835.1|[194267784]

250: ACF35834

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267783|gb|ACF35834.1|[194267783]

251: ACF35833

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267782|gb|ACF35833.1|[194267782]

252: ACF35832

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267781|gb|ACF35832.1|[194267781]

253: ACF35831

cytochrome b [Homo sapiens]

gi|194267779|gb|ACF35831.1|[194267779]

254: ACF35830

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267778|gb|ACF35830.1|[194267778]

255: ACF35829

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267777|gb|ACF35829.1|[194267777]

256: ACF35828

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267776|gb|ACF35828.1|[194267776]

257: ACF35827

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267775|gb|ACF35827.1|[194267775]

258: ACF35826

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267774|gb|ACF35826.1|[194267774]

259: ACF35825

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267773|gb|ACF35825.1|[194267773]

260: ACF35824

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267772|gb|ACF35824.1|[194267772]

261: ACF35823

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267771|gb|ACF35823.1|[194267771]

262: ACF35822

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267770|gb|ACF35822.1|[194267770]

263: ACF35821

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267769|gb|ACF35821.1|[194267769]

264: ACF35820

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267768|gb|ACF35820.1|[194267768]

265: ACF35819

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267767|gb|ACF35819.1|[194267767]

266: ACF35818

cytochrome b [Homo sapiens]

gi|194267765|gb|ACF35818.1|[194267765]

267: ACF35817

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267764|gb|ACF35817.1|[194267764]

268: ACF35816

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267763|gb|ACF35816.1|[194267763]

269: ACF35815

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267762|gb|ACF35815.1|[194267762]

270: ACF35814

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267761|gb|ACF35814.1|[194267761]

271: ACF35813

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267760|gb|ACF35813.1|[194267760]

272: ACF35812

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267759|gb|ACF35812.1|[194267759]

273: ACF35811

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267758|gb|ACF35811.1|[194267758]

274: ACF35810

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267757|gb|ACF35810.1|[194267757]

275: ACF35809

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267756|gb|ACF35809.1|[194267756]

276: ACF35808

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267755|gb|ACF35808.1|[194267755]

277: ACF35807

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267754|gb|ACF35807.1|[194267754]

278: ACF35806

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267753|gb|ACF35806.1|[194267753]

279: ACF35805

cytochrome b [Homo sapiens]

gi|194267751|gb|ACF35805.1|[194267751]

280: ACF35804

NADH dehydrogenase subunit 6 [Homo sapiens]

gi|194267750|gb|ACF35804.1|[194267750]

281: ACF35803

NADH dehydrogenase subunit 5 [Homo sapiens]

gi|194267749|gb|ACF35803.1|[194267749]

282: ACF35802

NADH dehydrogenase subunit 4 [Homo sapiens]

gi|194267748|gb|ACF35802.1|[194267748]

283: ACF35801

NADH dehydrogenase subunit 4L [Homo sapiens]

gi|194267747|gb|ACF35801.1|[194267747]

284: ACF35800

NADH dehydrogenase subunit 3 [Homo sapiens]

gi|194267746|gb|ACF35800.1|[194267746]

285: ACF35799

cytochrome c oxidase subunit III [Homo sapiens]

gi|194267745|gb|ACF35799.1|[194267745]

286: ACF35798

ATP synthase F0 subunit 6 [Homo sapiens]

gi|194267744|gb|ACF35798.1|[194267744]

287: ACF35797

ATP synthase F0 subunit 8 [Homo sapiens]

gi|194267743|gb|ACF35797.1|[194267743]

288: ACF35796

cytochrome c oxidase subunit II [Homo sapiens]

gi|194267742|gb|ACF35796.1|[194267742]

289: ACF35795

cytochrome c oxidase subunit I [Homo sapiens]

gi|194267741|gb|ACF35795.1|[194267741]

290: ACF35794

NADH dehydrogenase subunit 2 [Homo sapiens]

gi|194267740|gb|ACF35794.1|[194267740]

291: ACF35793

NADH dehydrogenase subunit 1 [Homo sapiens]

gi|194267739|gb|ACF35793.1|[194267739]

292: NP_002275

keratin 86 [Homo sapiens]

gi|14318422|ref|NP_002275.1|[14318422]

293: ACD31678

cytochrome c oxidase subunit III [Homo sapiens]

gi|187729692|gb|ACD31678.1|[187729692]

294: ACD31677

ATPase subunit 6 [Homo sapiens]

gi|187729691|gb|ACD31677.1|[187729691]

295: ACC97189

cytochrome c oxidase subunit II [Homo sapiens]

gi|186968864|gb|ACC97189.1|[186968864]

296: NP_001073848

parkin co-regulated gene protein isoform 2 [Homo sapiens]

gi|122939206|ref|NP_001073848.1|[122939206]

297: NP_001073847

parkin co-regulated gene protein isoform 2 [Homo sapiens]

gi|122939202|ref|NP_001073847.1|[122939202]

298: NP_689623

parkin co-regulated gene protein isoform 1 [Homo sapiens]

gi|122939204|ref|NP_689623.2|[122939204]

SNPs Database

1: rs41318531 

[Homo sapiens]

AACTGGACTCAGGCCTTTTGGCCTCA[A/G]AGAAGCTCACAGTGTGAGAGTATGA

2: rs41352448 

[Homo sapiens]

ATGGATGGATGGATGGATGGATGGAT[-/GGAT]GGACAGACAGCTATAGAAATAC AGA

3: rs13447341 

[Homo sapiens]

GGAGCTGGTGAAGCGGAAGCGCATCG[A/G]GGCCATCCGCGGCCAGATCCTGTCC

4: rs45484397 

[Homo sapiens]

ATTGTGGGTCTGGTGGTTATGGAATG[G/T]TGGTGGTAACAGTGGTGTGATGGAA

5: rs3917220 

[Homo sapiens]

CAAGGGACTCTAATCTACCTTGTTCT[-/T]TCTGTTCTCTTCAGAACTCCAAGCT

6: rs35706870 

[Homo sapiens]

CCAAGGGCAGATGTGCATGGAGGCCA[A/C]GTCATTTCCTTCCCATGCTCTCATA

7: rs13447446 

[Homo sapiens]

ATCTTTGTTGGAGGGTGAGGGTGGGG[A/C]CAGAGCGGGTGGGGCTGATTGGAAA

8: rs13447445 

[Homo sapiens]

GTTGAGACTCTAATATTGAGACTCAT[C/G]GGAAAATCCCACATTTGATAAATCT

9: rs56588968 has merged into rs1800795 

[Homo sapiens]

CACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA

10. AFFY, HGBASE, SNP500CANCER10: rs36215460 has merged into rs1800795 

[Homo sapiens]

CACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA

11.AFFY, HGBASE, SNP500CANCER11: rs17777058 has merged into rs1800795 

[Homo sapiens]

CACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA

12.AFFY, HGBASE, SNP500CANCER12: rs1800795 

[Homo sapiens]

CACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA

13.AFFY, HGBASE, SNP500CANCER13: rs41296860 

[Homo sapiens]

AACTGGACTCAGGCCTTTTGGCCTCA[A/G]AGAAGCTCACAGTGTGAGAGT

OMIM Database

1. *608427 PARKIN COREGULATED GENE; PACRG
     Gene map locus 6q25-q27

2. #607572 LEPROSY, SUSCEPTIBILITY TO, 2
    Gene map locus 6q25.2-q27

3. *602544 PARKIN; PARK2  FRAGILE SITE FRA6E, INCLUDED
      Gene map locus 6q25.2-q27

4. *601928 KERATIN 86; KRT86
      Gene map locus 12q13

5. *601772 H2A HISTONE FAMILY, MEMBER X; H2AFX
     Gene map locus 11q23.2-q23.3

6. *516002 COMPLEX I, SUBUNIT ND3; MTND3

7. #246300 LEPROSY, SUSCEPTIBILITY TO LEPROSY, SUSCEPTIBILITY TO, 3, INCLUDED; LPRS3, INCLUDED

    Gene map locus 4q32, 4p14

8. *124092 INTERLEUKIN 10; IL10
     Gene map locus 1q31-q32

9. #114500 COLORECTAL CANCER; CRC
    Gene map locus 17q24, 17p11.2, 17p13.1, 15q15, 14q32.3, 14q24.3, 11p11.2, 9q32-q33, 1p13.2, 8p22-p21.3, 5q21-q22, 4q32, 3q26.3, 1p35, 2p25, 22q13, 20q13.2-q13.3

10. #114480 BREAST CANCER  BREAST CANCER, FAMILIAL MALE, INCLUDED
      Gene map locus 17q22-q23, 17q22, 17p13.1, 16p12, 15q15.1, 14q32.3, 13q12.3, 12p12.1, 11q22.3, 11p15.5, 8q11, 5q33.2, 3q26.3, 2q34-q35, 2q33, 22q12.1

ANNEXURE - III

 

Organization of Conferences / Workshops

Organized International Symposium on Human Genomics and Public Health along with the XXXI Annual Conference of Indian Society of Human Genetics, February 27-March1, 2006.

Organized Guha Research Conference (GRC) 2006 at Leh, Ladakh, J&K as a Co-Coordinator.

Organized International Symposium of Environmental Health Sciences in the 21st Century along with the XXVI Annual Conference of Environmental Mutagene Society (EMSI) of India, March 2001& Guest-Edited the Journal volume of JEPTO (Journal of Environmental pathology, Toxicology and Oncogenesis, USA) with selected papers.

Workshop on non-radioactive approach to Southern and Northern hybridization through chemiluminescence in 1991-1992.

Workshop on cytogenetic and molecular techniques for WHO supported young researchers with AIIMS in 1995-96

Scientific and Public Lectures (since 2003)

  1. Invited Lecture on “Genomics and Bioinformatics in Complex Human Diseases” in the 29th Annual Conference of Association of Clinical Biochemists of India, 3rd to 5th February, 2003, Jaipur.
  2. Chaired the session on Genomics, Proteomics and Bioinformatics with Dr. D.S.Rao, AIIMS in the 29th Annual Conference of Association of Clinical Biochemists of India, 3rd to 5th February, 2003, Jaipur.
  3. Invited Lecture in a Plenary Session on “An exporatory study of low resolution mapping and prediction of probable susceptibility genes at 17q21-24 region in sporadic breast cancer: an experimental and bioinformatics approach” , XXVIII Annual Conference of the Environmental Mutagen Society of India (EMSI), February 14-16, 2003, Indian Institute of Chemical Biology (CSIR), Jadavpur, Kolkata-700032.
  4. Chaired the Plenary Session on ‘Basic and Applied aspects  of Environmental Mutagenesis and carcinogenesis’ with Dr. P. Simeonova of USA, XXVIII EMSI Annual Conference and Symposium on Arsenic Contamination in ground water and its health effects, IICB, Kolkata.
  5. Presented the viewpoints on “Cloning and Bioethics” in the Centre of Law and Governance, JNU 20th February, 2003.
  6. Delivered a lecture at the Department of Biotechnology, DD University, Gorakhpur on “Genomic Polymorphism and Diseases” on 4th of March, 2003.
  7. Delivered a lecture at the Department of Zoology and Allied Sciences, H.N.Bahuguna University, Srinagar, Garhwal on 8th of April, 2003.
  8. Delivered Two Lectures on “Human Genome and Disease” at the Academic Staff College, April 28th, 2003.
  9. Delivered an Invited lecture in the 8th Iran Genetics Society Meeting at Milaad Congress Centre, Tehran- Iran, 20-22nd May, 2003.
  10. Delivered Two Lectures in the Academic Staff College, 18 -19th July, 2003.
  11. Delivered a Plenary Lecture on, ‘Mapping of the gene(s) in sporadic breast cancer characterized for BRCA2 genetic background’ and Chaired Two Scientific Sessions in the “National Seminar on Interdisciplinary Approaches in Zoological Research” September 29th –October 1, 2003, University of Kashmir, Srinagar (J&K).
  12. Delivered Four Lectures in the Academic Staff College, GND University, Amritsar, 17th and 18th of October, 2003.
  13. Delivered a Lecture to the M.Sc. students of the National Centre for Human Genomic Studies and Research, Panjab University, Chandigarh, 29th of October, 2003.
  14. Delivered Two Lectures in the Academic Staff College, Gurukul Kagri University, Haridwar, 29th of November, 2003.
  15. Delivered Two Invited Lectures on “Human Genome: History and Reality and Human Genome”: Social and Ethical Issues in the Administarive Academy, Gurgaon ( Part of series of lectures on ‘Fostering a temper and using scientific and technical inputs for accelerating the pace of development with special emphasis on biotechnology and prototype development’), December 9th, 2003.
  16. Delivered an Invited Lecture in EMERGE TECH 2003, Conclave on Emerging Technologies, organized by Confederation of Indian Industry (CII), Northern Region, 11th December, 2003, Hotel Taj Palace, New Delhi.
  17. Delivered an Invited Talk to the graduate students of Zoology and other science disciplines on the Annual Function of the Zoological Society of the Deshbandhu College, New Delhi on 17th December, 2003.
  18. Delivered three lectures in the 9th Refresher Course in Life Sciences, Academic Staff College, J.N.U., New Delhi, on 19th of January, 2004.
  19. Delivered a Plenary Lecture on “Genomics to System Biology: A Paradigm shift” in the 7th Punjab Science congress, Guru Nanak Dev University, Amritsar on February 6th 2004.
  20. Delivered an Invited Lecture in the Amity International Centre on 20th February 2004
  21. Delivered an Invited talk at the Department of Biophysics, Molecular Biology & Genetics, University College of Science, University of Calcutta on 3rd April 2004.
  22. Delivered an Planetary lecture on “Mapping the gene(s) ---- genetic background” in the International Conference on Human Genome Update, Institute of genetics & Hospital for Genetic Disorders, Osmania University, Hyderabad on 30th August 2004.
  23. Delivered an Invited Lecture in the International workshop on “Application of Advance Molecular Methods for Diagnosis of Human Genetics Disease” from 13th – 17th September 2004 at National Research Center for Genetic Engineering & Biotechnology, Iran.
  24. Delivered an Invited Special Lecture on “Genotype Phenotype correlations in system biology paradigm” in the 2-Day Seminar “Genetics-The expanding Horizon” Department of Genetics, South Campus, University of Delhi on 13th October 2004.
  25. Delivered an Invited lecture on “Anatomy of Human Chromosomes in Relation to structural and functional genomics” in the Biosparks 2004, Desh Bandhu College on the theme “Science Overtakes fiction” on 4th November, 2004.
  26. Delivered an Inaugural lecture on “Human Genome Perspectives and its Implications” to the participants of 50th Orientation Course on 22nd November, 2004.
  27. Delivered an Invited Talk on “Human Genomic” to the graduate students of Zoology and other science disciplines on the Annual Festival Chrysalis-2004 of the Maitreyi College, New Delhi on 30th November, 2004.
  28. Delivered lecture on “Genotype Phenotype relations and mapping of unknown genes” in the 10th Refresher Course in Life Sciences, Academic Staff College, J.N.U., New Delhi, on 28th of December, 2004.
  29. Delivered an Inaugural Lecture in Academic Staff College, JNU New Delhi.
  30. Delivered lecture in the 9th Refresher Course in Life Sciences, School of Life Sciences, JNU, New Delhi.
  31. Delivered a Planetary Lecture on, “Perspective of Molecular Medicine in the Background of Human Genome Information - A Case Study of Cancer” in the session Molecular Medicine of “Med Biotech 2005”, Department of Biotechnology, Punjabi University, on February 2nd 2005, Patiala.
  32. Delivered an Invited Lecture on “Study of a simple and a complex genetic disorder in humans – exploring unknowns” at Indian Institute of Sciences, Bangalore on 10th February 2005.
  33. Delivered an Invited Lecture in Academic Staff College, Department of Zoology, University of Pune, Pune 11th February, 2005.
  34. Delivered an Invited Lecture in the Department of Zoology, Banaras Hindu University, Varanasi on 15th February, 2005.
  35. Delivered an Invited Lecture on “SNPs and microsatellite variations in hepatitis and cancer – future pharmacogenomic targets” in the Workshop on “Drug Discovery and Development in New Millennium (D3NM-2) Interfacing with in silico, cell based and Pharmacological Toxilogical Experimentation” at National Institute of Pharmaceutical Education and Research (Niper) on March 1st 2005.
  36. Delivered an Invited Lecture on “Genetic Heterogeneity in Susceptibility to Leprosy” in the Asian Regional Workshop on “Emerging Infectious Diseases” at India Habitat Centre, New Delhi on 11th March, 2005.
  37. Delivered an Invited Lecture on “Understanding Disease Susceptibilities In The Background Of Present Day Perspectives Of Human Genome Information Our Experience” in the “APOGEE2K5” at BITS, Pilani, Rajasthan, on 17th March, 2005.
  38. Delivered an Invited Lecture on “Challenges of tracking new genes and establishing genotype-phenotype correlations in the background of the human genome information our experience” in the “Genomics 2005: Challenges and opportunities” at National Genome for Plant Genome Research, New Delhi, on 2nd May, 2005.
  39. Delivered invited lecture at the Academic Staff College, JNU for the Refresher course in Biotechnology on, “Human Genomics and Public Health” 14th September, 2005.
  40. Chief Guest at the Zoological Society of Ramjas College and deliver the Invited Lecture on, “Human Genomic Variation and Public Health” 23rd September, 2005.
  41. Delivered invited lecture on “Human Genomics variations in simple and Complex diseases-  A Paradigm shift in relation to Public Health” at Department of Zoology, Allahabad University on 20th October, 2005.
  42. Delivered invited lecture on “Human Genomics in Service of Mankind – A Future Prospective” at Department of Botany, Raghunath College, Meerut on 18th November, 2005.
  43. Delivered invited lecture on “A Putative Tumor Suppressor in 17q with Possible Association with Sporadic Breast Cancer” at the Seminar on Molecular Biology of Stress Response and its Application, BARC, Mumbai on 20th December, 2005.
  44. Delivered invited inaugural lecture at Academic Staff College, Jawaharlal Nehru University, New Delhi on 02nd January, 2006.
  45. Delivered invited lecture on “Structural to functional Genomics- Bloom Syndrome as a model” at Academic Staff College, Jawaharlal Nehru University, New Delhi on 3rd  January, 2006.
  46. Delivered invited plenary lecture on “A Putative tumor Suppressor in 17q with sporadic breast cancer” at International Symposium on Frontiers in Genetics and Biotechnology - Retrospect and Prospect, Osmania University, Hyderabad on 09th January, 2006.
  47. Delivered invited lecture on “Mapping of new tumor suppressor genes using LOH studies” at Sri Satya Sai Institute of Higher Learning, Prasanthinilayam, AP on 28th January 2006.
  48. Delivered invited inaugural lecture on “Human Genomic variation and Disease” at Hansraj College, University of Delhi for the SHRISHTI CHETNA the Annual Festival of Biological and Zoological Society  on 07th February, 2006.
  49. Delivered invited lecture on “Present and future of Human Genomics” at 3rd hands on training workshop on methods in gene analysis in Centre for Genomics, School of Studies in Zoology, Giwaji University, Gwalior on 11th March, 2006.
  50. Delivered invited lecture on “Perspective and understanding the role of Human Genome” at National Symposium on Recent Trends in Modern Biology, Department of Zoology, University of Pune on 16th March, 2006.
  51. Delivered invited lecture at Paravara Institute of Medical Sciences on 17th March, 2006.
  52. Delivered invited lecture on “Cancer Genomics in Post genomic Era” at SGPGI, Lucknow on 20th May, 2006.
  53. Delivered invited lecture on “Human Genome Variations and determination of Molecular Signatures in Human Diseases” at Summer Research Training Programm, SLS, JNU on 22nd May 2006.
  54. Delivered Invited Lecture on “How and why are we different” at Jiwaji University, Gwalior, on 2nd June, 2006.
  55. Delivered Invited Lecture on “Human Genome Studies in the Post Genomic Era” at Zoology Department, University of Kashmir, on 5th June, 2006.
  56. Delivered Invited inaugural lecture on “Tracking new genes and establishing genotype-phenotype correlations in the background of Human Genome information- our experience in Breast Cancer” at XXXII Annual Day Conference of the Society of Young Scientists, AIIMS, New Delhi on 29th July 2006.
  57. Delivered Invited Lecture on “Genomics to system Biology Information for life and a shift in Biological paradigm” at Academic Staff College, on 9th August 2006.
  58. Delivered Invited Lecture on “Historical Perspectives in Human Genomics and future vision” at School of Zoological Services, Jiwaji University, Gwalior, on 10th August 2006.
  59. Delivered Invited Lecture on “Recent Trends in Genomics” and chaired a session at Annual Conference of International Medical Academy, Dental College, Lahore, Pakistan on 3rd November, 2006.
  60. Delivered Invited Lecture on “Human Genome perspectives in Biotechnology”  MBA Biosciences students at Pravara Institute of Medical Sciences (Deemed University) Loni Maharashtra on 29th November, 2006.
  61. Delivered Invited Lecture on “Tracking new tumor suppressor genes-strategies and results in sporadic form of breast cancer” at ‘National Seminar on New Trends in Life Sciences’ Department of Zoology, Panjab University, Chandigarh on 11th December, 2006.
  62. Delivered Invited Lecture on “How are we different and what methodologies do we adopt to track new genes in the perspective of developments in Human Genomics”,(three lectures) on refresher course for college teachers, Department of Zoology, Jammu University, Jammu on 19th and 20th December, 2006.
  63. Delivered Invited Lecture on “Bioethical issues in human genome research – in the perspective of preimplantation genetic diagnosis”, in the Seminar on National Consultation on new reproductive technologies and their implications on women, Jawaharlal Nehru University on 3rd - 5th January 2007.
  64. Delivered Invited Lecture on “Beyond Human Genome”, in the DBT sponsored refresher course in Biotechnology at the School of Biotechnology, Jawaharlal Nehru University on 8th January 2007.
  65. Delivered Invited Lecture on “Use of DNA Fingerprinting in detection of Homicide Crimes”, in the Investigation of Homocide Cases Including Custodial Death and Capsule on Human Rights at the Central Bureau of Investigation Academy, Government of India, Kamla Nehru Nagar, Hapur Road, Ghaziabad, on 17th January 2007.
  66. Delivered Two Invited Lectures on “Genomic Variation and its utility”, in the 12th Refresher Course in life Sciences at Academic Staff College, Jawaharlal Nehru University on 18th January 2007.
  67. Chaired a session on “Evolutionary Biology” and delivered an invited Lecture on “Tracking new chromosomal regions and assessing the expression of some of the sensors, adaptors and effectors in sporadic breast cancer”, in the 30th All India Cell Biology Conference and Symposium on Molecules to compartments: Cross-Talks and Networks, on 2nd and 4th February 2007, respectively.
  68. Delivered an invited Lecture on “How complex are infectious disease – Leprosy as a model?” and chaired a session in the XXXII Annual Conference of Indian Society of Human Genetics and international Symposium on Deconstructing Human Diseases: The Genomic Advantage, on 14th and 16th February 2007 respectively.
  69. Delivered an invited Lecture on “Tracking chromosomal regions to hunt for genes and to assay the expression of DNA damage response genes in cancer” at Sri Sathya Sai University, Vidyagiri Complex, Prasanthinilayam, AP on 10th March 2007.
  70. Delivered an invited Lecture on “Beyond Human Genomics: Genomic variations and environment response” at CORD and Environmental Sciences, University of Kashmir, Srinagar on 14th May, 2007.
  71. Delivered an invited Lecture on “Physical mapping and candidate gene approach to understand the sporadic breast tumor heterogeneity” at DBT organized International Symposium on Trends in Human Genetics, Tohali Sands, Puri, Orissa on August 20-22, 2007
  72. Delivered an invited Lecture on “Physical mapping and candidate gene approach to understand the sporadic breast tumor heterogeneity” at DBT organized International Symposium on Trends in Human Genetics, Tohali Sands, Puri, Orissa on August 20-22, 2007.
  73. Delivered a valedictory address on “Global explorations of human genome and its implications – lessons to be learned” to the participants of the 9th Refresher Course in Biotechnology, Academic Staff College, JNU on August 24, 2007
  74. Delivered an invited lecture on “Relevance of New Biology to Medical Sciences” at King George Medical College, Lucknow on October 16, 2007
  75. Delivered a keynote address in the “National Seminar on Genome Analysis perspective in the post-genomic era and its relevance to society” at School of Human Genome Research and Genetic Disorders and School of Biotechnology, Mahatma Gandhi National Institute of Research and Social Action (MGNIRSA), Hyderabad on October 26, 2007.
  76. Delivered a Plenary Lecture on “Genomic variance and their relevance in the post-genomic era” in the National Seminar on Genome Analysis perspective in the post-genomic era and its relevance to society at School of Human Genome Research and Genetic Disorders and School of Biotechnology, Mahatma Gandhi National Institute of Research and Social Action (MGNIRSA), Hyderabad on October 26, 2007.
  77. Chaired session I on “Genome Science/Comparative Genomics” in the National Seminar on Genome Analysis perspective in the post-genomic era and its relevance to society at School of Human Genome Research and Genetic Disorders and School of Biotechnology, Mahatma Gandhi National Institute of Research and Social Action (MGNIRSA), Hyderabad on October 26, 2007.
  78. Delivered an Invited Lecture on “Human Genomic Variations and environment response” in the National Symposium on biomarkers of Environmental Problems at Department of zoology, C.C.S. University, Meerut on October 28, 2007.
  79. Delivered an Invited Lecture on “Mapping and Candidate gene approach to understand the sporadic breast tumor heterogeneity” in the 1st International Congress on Health Genomics and Biotechnology, Tehran, Iran on November 24-26, 2007.
  80. Delivered an Invited Lecture on “Role of Mitochondria in the Background of Implicated Nuclear Candidate Genes in the Type2 Diabetes Mellitus in India” in the Scientific Session on “Dissecting the Role of Genes and Environment in Complex Diseases”, at CCMB, Hyderabad December 6, 2007.
  81. Delivered an Invited Lecture on “Understanding Complex Diseases In The Post- Human Genome Era” in the 12th Foundation day Symposium of Biotechnology Society of India, Molecular Medicine, The emerging frontiers, PGIMS, Rohtak on 9th January 2008.
  82. Delivered Invited Lectures on “Genes And Genetics”, in the 12th Orientation Course in life Sciences at Academic Staff College, Jawaharlal Nehru University on 14th January 2008.
  83. Delivered an Invited Lecture on “Genomic Variations And Their Interaction-Assessment Of Risk To Complex Diseases” in the Biotech Fest 2008 in the Department of Biotechnology, Panjab University, Chandigarh on January 17, 2008.
  84. Delivered an Invited Lecture on “Dissecting Complex Diseases in the Post-Human Genome era; Our Experience” in the XXXIII Annual Conference of the Indian Society of Human Genetics (ISHG) and International Symposium on Genetics Revisited: The Genomics and Proteomics Advantage at Department of Human Genetics, Andhra University, Visakhapatnam on February 11-13, 2008.
  85. Chaired Session-II in the XXXIII Annual Conference of the Indian Society of Human Genetics (ISHG) and International Symposium on Genetics Revisited: The Genomics and Proteomics Advantage at Department of Human Genetics, Andhra University, Visakhapatnam on February 11, 2008.
  86. Delivered an Invited Lecture on “Dissecting Complex Diseases in the Post-Human Genome era; Our Experience” in the XXXIII Annual Conference of the Indian Society of Human Genetics (ISHG) and International Symposium on Genetics Revisited: The Genomics and Proteomics Advantage at Department of Human Genetics, Andhra University, Visakhapatnam on February 11-13, 2008.
  87. Delivered an Invited Lecture on “Genotype Mosaic status of the Genes in the Pathway Biology and their Interaction to understand the Complex disease Phenotypes” in the OMICS, In The 21st Century, Fifth International Symposium on Genetics, Health and Disease, at Guru Nanak Dev University, Amritsar on February 19, 2008.
  88. Chaired Session-7 on “Medical Genetics in Omics era” in the OMICS, In The 21st Century, Fifth International Symposium on Genetics, Health and Disease, at Guru Nanak Dev University, Amritsar on February 19, 2008.
  89. Delivered a Keynote address on “Dissecting Complex Diseases in Post Genomic Era” in the inaugural session of the workshop on “Genotyping Techniques in Clinical Diagnostics” at National Institute for Research in Reproductive Health (NIRRH)  Mumbai on 28th April, 2008.
  90. Delivered an Invited Lecture on “Humans as genotype mosaics show differential interaction of the pathway biology genes to explain complex disease phenotypes” at School of life science, University of Hyderabad, Hyderabad on August 23, 2008.
  91. Delivered a Keynote Lecture on “Gene-gene variation interaction in post genome wide studies to understand complex diseases” in the Technical Session -VI (Genomics & Proteomics) of the International Conference: Emerging trends in Biological Sciences at School of Biotechnology, KIIT University, Bhubaneswar, Orissa on October 25, 2008.
  92. Delivered an Inaugural Lecture on “Recent Advances in Genomics and Proteomics” in the Continuing Education Programme on The Recent Advances in Genomics and Proteomics Research at Defence Institute of Physiology and Allied Sciences (DIPAS), DRDO, Ministry of Defence, Lucknow Road, Delhi –110054 on November 10, 2008.
  93. Delivered an Invited Lecture on “Whole mitochondria genome studies in north Indian population diversity and complex diseases” in the 2nd Indo-US Workshop on Mitochondrial Research and Medicine at Manipal Life Sciences Centre, Manipal University, Manipal on November 13, 2008.
  94. Delivered two Invited Lecture on “Genes and Diseases” and “Human Disease Models to Understand Susceptibility to Complex Diseases” in the 14th Refresher Course in Life Sciences at Academic Staff College, Jawaharlal Nehru University, New Delhi on January 16 and 20, 2009.
  95. Chief Guest in the Refresher Course in Life Sciences, Centre for Professional Development in Higher Education and delivered an Inaugural Lecture on “Detection of functional variations in Human Genome – A key to understand disease susceptibilities” in the Refresher Course in Life Sciences, Centre for Professional Development in Higher Education at Department of Zoology, University of Delhi on January 29, 2009.
  96. Setting the theme of the Inaugural Session of the International Conference on Genetic and Molecular Diagnosis in Modern Medicine “Detection and understanding of disease biology – crucial to therapeutic intervention and prevention” at Kamineni Education Society, 103, Kanchanjunga, King Koti Road, Abdis, Hyderabad – 500001 on 13th February, 2009.
  97. Chaired the Session III on Clinical Genetic and Epigenetics Aspects of Cancer, of the International Conference on Genetic and Molecular Diagnosis in Modern Medicine – (GMDMM-09) at Kamineni Education Society, 103, Kanchanjunga, King Koti Road, Abdis, Hyderabad – 500001 on 13th February, 2009.
  98. Chaired a Session in the International Symposium on ‘Frontiers in Molecular Medicine’ at Jawaharlal Nehru University, New Delhi on 14th February 2009.
  99. Delivered an Invited Lecture on “Gene variation interaction and real time expression studies of the candidate genes associated with chromatin, DNA damage response, apoptosis, immune response and mitochondria in Sporadic Breast Cancer” in the 28th Annual Convention of Indian Association for Cancer Research & International Symposium on Emerging Challenges and Approaches in Cancer Biology at National Science Seminar Complex, Indian Institute of Science, Bangalore on 21st – 24th February, 2009.
  100. Chaired Session VIII (Shri Sitaram Joglekar / Smt. Mangala Bamane Award) of the 28th Annual Convention of Indian Association for Cancer Research & International Symposium on Emerging Challenges and Approaches in Cancer Biology at National Science Seminar Complex, Indian Institute of Science, Bangalore on 21st – 24th February, 2009.
  101. Delivered an Invited Lecture on “How we are different?” in the Program for JNU Science Festival 2009 on February 28, 2009.
  102. Delivered an Invited Lecture on “Interaction and real time expression of nuclear candidate genes and mitochondrial genome studies in complex genetic diseases” in the ISHG 2009 International Symposium on ‘Ethics, Culture and population Genomics’ and 34th Annual Conference of the Indian Society of Human Genetics from 17th – 20th March, 2009.
  103. Delivered an Invited Lecture on “Bioethical Issues in human genome research – In the perspective of preimplantation genetic diagnosis (PIGD)” in the ISHG 2009 International Symposium on ‘Ethics, Culture and population Genomics’ and 34th Annual Conference of the Indian Society of Human Genetics from 17th – 20th March, 2009.
  104. Delivered an Invited Lecture on “Host Genetic Susceptibility to Mycobacterial Diseases – Leprosy as a model” in the National Symposium on ‘Biotechnology in the post genomic era’ at Department of Biochemical Technology, Sri Venkateswara College, University of Delhi on 09th April, 2009.
  105. Delivered an Invited Lecture on “Post-genomic advancements and genomic medicine” in the National Seminar on ‘Translational Health Research: Pathways to Discovery’ at CSM medical University, Lucknow, U.P. on 28th April, 2009.

Administrative / Academic Experience

  1. Incharge - Genetics Unit, Anatomy Department, Institute of Medical Sciences, Banaras Hindu University, Varanasi, 1980-1989
  2. Coordinator- Bioinformatics Centre, Jawaharlal Nehru University, New Delhi, 1997-1998
  3. Coordinator- National Centre of Applied Human Genetics, School of Life Sciences, JNU, New Delhi (2002- onwards)
  4. Dean-School of Life Sciences, Jawaharlal Nehru University, New Delhi (2004-2006)
  5. Member Academic Council, Pondicherry University, Pravara Rural University (Previously known as Pravara Institute of Medical Sciences), Deemed University, Loni, Ahmednagar, Maharashtra and (in the past) Islamic University of Science and Technology (Awantipora, Srinagar).
  6. Member Executive Council, Pondicherry University, Pondicherry & Central Univ. Jharkhand.
  7. Served as Member Xth Plan Committee of UGC for different Universities and XI Plan committee for UGC and DBT.
  8. UGC-Expert Committee Member for University with Potential for Excellence-and for  Centre of Advanced Studies for different Universities
  9. Member Sub-Committee on “Promotion of Science Education in Universities” and “Strengthening of IUCs”, constituted by UGC at the behest of HRD-Ministry, 2003.
  10. UGC- Committee Member to “Formulate the Xth Plan Profile of Higher Education in India”, May 2001.
  11. Served as Member of the UGC Committee for evaluating the Deemed University status to be given to TIFR, Mumbai/NCBS, Bangalore and for evaluation of Pravara Rural University.
  12. Member Sub-Committee National Institute of Educational Planning and Administration (NIEPA)-on Higher Education System, 2001; also for Post retirement service.
  13. Expert Committee Member to see the feasibility to establish Human Genomics Centre in the Chandigarh University, Chandigarh.
  14. Member UGC-Committee –Absorption of Migrant Teachers of Kashmir University, 2000.
  15. Expert Committee member for selecting teachers for travel grant, major research projects, seminars and symposia, research awards, National Lecturer, etc.
  16. Expert Member-Advisory Committee of SAP (DRS, DSA etc) –UGC for different Universities.
  17. Expert Member on Faculty Boards, Departmental Boards and Past and present Academic Committee of different universities.
  18. Member of different institutions outside JNU: National Institute of Immunology, New Delhi, Raman Research Institute, Bangalore (in the past), Military College of Engineering, Pune (in the past), IMMTECH, Chandigarh, CDRI, Lucknow, ICGEB, New Delhi (in the past).
  19. Expert Member-Advisory Committee of SAP (DRS, DSA etc) –UGC at different Universities, Calcutta University, Gwalior University, Indian Institute of Sciences, Bangalore, Madras University, Anna University, Chennai, University of Kashmir, Kashmir, University of Delhi, Delhi, Banaras Hindu University, Varanasi, Sri Satya Sai Institute of Higher Learning, Puttaparthy, Guru Nanak Dev University, Amritsar.
  20. Expert Member to review DSA programmes in different Universities.
  21. Member of different institutions outside JNU: National Institute of Immunology, New Delhi, Raman Research Institute, Bangalore (in the past), Military College of Engineering, Pune (in the past), IMMTECH, Chandigarh, CDRI, Lucknow, ICGEB, New Delhi (in the past).
  22. Within JNU (in the past): Member Court, Jawaharlal Nehru University, Member Executive Council, Jawaharlal Nehru University, Member Academic Council, Jawaharlal Nehru Unviersity, Member Special Committee of School of Computer and System Sciences, School of Environmental Sciences, Member Board of Studies of Centre for Studies in Science Policy, School of Social Sciences, Zakir Hussain Centre for Educational Studies, School of Social Sciences.
  23. Within JNU (Currently): Chairman, Ethical Committee (IERB, JNU), Chairman, Monitoring Committee, Member Court, JNU, Member Academic Council, JNU.

Top